Question

In: Psychology

Respond briefly to ONE (1) of the following therapeutic interventions as it corresponds to a client...

Respond briefly to ONE (1) of the following therapeutic interventions as it corresponds to a client with Depression:

A. Explore how depression is experienced in a client's day-to-day living.

B. Ask a client to make a list of what he/she is depressed about and process list with a therapist.

C. Encourage sharing feelings of depression in order to clarify them and gain insight as to causes.

D. Explore experiences from a client's childhood that contribute to current depressed states.

E. Encourage client to share feelings of anger regarding pain inflicted on him/her in childhood that contributes to current depressed state.

Solutions

Expert Solution

D. Explore experiences from a client's childhood that contribute to current depressed states

Answer: From a psychoanalytic point of view, depression is a symptom; a symptom of something else that has not been put into words, has not been expressed and is finding a way out through our body, making us depressed. That something could be years of childhood abuse and/or neglect; other traumatic experiences, including war, loss, death, rape, violence, or any kind of physical, emotional or political hardship; hurtful family or personal events; living with an abusive parent or a partner, etc.

The focus of treatment is exploration of the patient's mind and habitual thought patterns. Such therapy is termed "non-directed." It is also "insight-oriented," meaning that the goal of treatment is increased understanding of the sources of one's inner conflicts and emotional problems. The basic techniques of psychoanalytical treatment include: Therapist neutrality, Free association,Therapeutic alliance and transference,Interpretation and Working through.

In general, this approach to treatment is considered successful if the patient has shown:

  • reduction in intensity or number of symptoms
  • some resolution of basic emotional conflicts
  • increased independence and self-esteem
  • improved functioning and adaptation to life

Related Solutions

Description of procedure Indications Outcomes/Evaluation Potential complications(Pre, intra, post) Client Education Nursing Interventions 1. Therapeutic procedure:...
Description of procedure Indications Outcomes/Evaluation Potential complications(Pre, intra, post) Client Education Nursing Interventions 1. Therapeutic procedure: Cerebral Thrombectomy
Medication templates, epinephrine, expected pharmacological action, therapeutic use, complications, medication administration, contraindications,nursing interventions, interaction, client education,...
Medication templates, epinephrine, expected pharmacological action, therapeutic use, complications, medication administration, contraindications,nursing interventions, interaction, client education, and evaluation of medication effectiveness
‏1-The client has been diagnosed with iron deficiency anaemia. The following are appropriate nursing interventions when...
‏1-The client has been diagnosed with iron deficiency anaemia. The following are appropriate nursing interventions when administering iron therapy, except: ‏Select one: ‏a. Advise the client to increase fluid intake. ‏b. Administer iron tablets with antacids to decrease GI toxicity. ‏c. Administer iron tablets before meals. ‏d. Inform the client that the stool will become black. 2-A diabetic patient had a blood glucose level of 130 mg/dL 30 minutes after lunch. Based on this assessment finding, what will be your...
#1)  Write down sample nursing diagnoses, interventions, and expected outcomes for the following client: Elaina, 27 years...
#1)  Write down sample nursing diagnoses, interventions, and expected outcomes for the following client: Elaina, 27 years old, visits a prenatal clinic to confirm a positive pregnancy test. Elaina tells the nurse that she is not married and has no support system. She also states that she is making minimum wage at a restaurant with no health insurance and cannot afford prenatal care. She intends to keep the baby and would rather not tell her partner because “they don’t have that...
The development of a therapeutic relationship with a client is central to the clinical process founded...
The development of a therapeutic relationship with a client is central to the clinical process founded both on the professional values and ethics of the social work profession.Explain the process and specific skills needed to developing a therapeutic relationship with a mandated client.
The following sequence of 30 nucleotides corresponds to one of the two strands of a double...
The following sequence of 30 nucleotides corresponds to one of the two strands of a double stranded DNA: 5’ GATGTGATCAGACCGGGTGCACTCTAATCT 3’ a) This sequence has two perfect palindromes that consist of 6 base pairs each. What is the sequence of these two palindromes? b) Show both strands of your FIRST palindrome (indicate the 5’-3’ polarity) c) Show both strands of your SECOND palindrome (indicate the 5’-3’ polarity) Assume that the two palindromes are recognized by “6-cutter” restriction enzymes, and that...
I need 3 nursing diagnoses and 9 nursing interventions (3 nursing interventions each) for this Client:...
I need 3 nursing diagnoses and 9 nursing interventions (3 nursing interventions each) for this Client: A psychiatric consultant was called to evaluate depression in Victor Alvarez, a 76-year-old-man who appeared dysphoric the day after surgery to repair a broken hip. It was late in the evening, and no one from the admitting team was available, but a social work note in the chart indicated that the patient’s fracture appeared to have been the result of his tripping in his...
Respond to one of the following in a minimum of 175 words: 1) Discuss: What are...
Respond to one of the following in a minimum of 175 words: 1) Discuss: What are the limitations of GDP as a measurement tool?
Respond to one of the following: 1. Consider the following statement: “F.O.B. destination means that title...
Respond to one of the following: 1. Consider the following statement: “F.O.B. destination means that title to the goods will switch to the buyer when goods are shipped.” Do you agree or disagree with the statement? Explain your answer. Also, what is the difference between an F.O.B. shipping point and an F.O.B. destination? Use at least one online reference to support your response. 2. What is the relationship between a purchase requisition and a purchase order? Why would a purchaser...
A client is refusing to takemorning medications. How should the nurse respond? ​A client is newly...
A client is refusing to takemorning medications. How should the nurse respond? ​A client is newly prescribed spironoloactone. List three (3) adverse effects of this medication the nurse should teach the client about. A nurse is caring for a client experiencing nausea, vomiting and anorexia due to chemotherapy treatment. What actions should the nurse take to treat this side effect? ​A client is administered midazolam to induce conscious sedation. List two (2) nursing actions in client care upon administration of...
ADVERTISEMENT
ADVERTISEMENT
ADVERTISEMENT