Question

In: Statistics and Probability

Derive below Results 1 to 4 from Axioms 1 to 3 given in Section 2.1.2 in...

Derive below Results 1 to 4 from Axioms 1 to 3 given in Section 2.1.2 in the textbook.

Result 1: P(Ac)=1−P(A)

Result 2 : For any two events A and B, P (A∪B) = P (A)+P (B)−P (A∩B)

Result 3: For any two events A and B, P(A) = P(A ∩ B) + P(A ∩ Bc)

Result 4: If B ⊂ A, then A ∩ B = B. Therefore, P(A) − P(B) = P(A ∩ Bc), and
P(A) P(B).

Solutions

Expert Solution


Related Solutions

Derive below Results 1 to 4 from Axioms 1 to 3. Axiom 1: P(A)≥ 0 Axiom...
Derive below Results 1 to 4 from Axioms 1 to 3. Axiom 1: P(A)≥ 0 Axiom 2: P(S)=1 Axiom 3: If A and B are mutually exclusive events, then P(A ∪ B)= P(A)+P(B) Result 1: P(Ac)=1−P(A) Result 2: For any two events A and B, P (A∪B) = P (A)+P (B)−P (A∩B) Result 3: For any two events A and B, P(A) = P(A ∩ B) + P(A ∩ Bc) Result 4: If B ⊂ A, then A ∩ B...
You are given the following results from a sample of five observations. 4 6 3 4...
You are given the following results from a sample of five observations. 4 6 3 4 3 ​ a. Construct a 99% confidence interval for the population variance. b. The null and alternative hypotheses are H0: σ2 ≥ 2 and Ha: σ2 < 2. Compute the test statistic. c. Perform the test of the hypothesis at the 1% level. d. What do you conclude about the population variance?
A researcher used cross-section data for the 10 areas to generate the results given below. Use...
A researcher used cross-section data for the 10 areas to generate the results given below. Use the regression results to estimate the following. Be sure to show your calculations for each question a) The estimate of Auto Sales for a population of 100. b) The 95% confidence interval for the estimate of Auto Sales for a population of 100. c) The 95% confidence interval for the slope coefficient for the population. Area Auto Sales Population 1 185792 133.17 2 85643...
Given the matrix as shown below n_array = 3 1 8 3 5 7 4 9...
Given the matrix as shown below n_array = 3 1 8 3 5 7 4 9 2 Write a M-file script program that generates this n_array, and answer each question using one line of MATLAB statement. a) Replace the second column of the n_array with a column of 0s b) Replace the element in the second-row, third-column with a zero c) Change the n_array to a 4 x 3 array by adding a row of 0s The end result for...
1. The given mRNA sequence is transcribed from the gene below it. 5’ AGCUUCGAACUCAUGCAGGGCCACCCGAUUACCAUGUAAGUUACGCA 3’ 3’...
1. The given mRNA sequence is transcribed from the gene below it. 5’ AGCUUCGAACUCAUGCAGGGCCACCCGAUUACCAUGUAAGUUACGCA 3’ 3’ TGAAGCATATTAGTACCGATGTCGAAGCTTGAGTACGTCCCGGTGGGCTAATGGTACATTCAATGCGT5’ 5’ ACTTCGTATAATCATGGCTACAGCTT CGAACTCATGCAGGGCCACCCGATTACCATGTAAGTTACGCA 3’ Within the double-stranded DNA above: a. Which strand ( top / bottom ) is the coding strand? b. Circle the -10 promoter element. c. Underline a single nucleotide indicating the transcription start site. d. Circle the translation start and stop codons. e. What is the amino acid sequence encoded by the mRNA given? Don’t forget that there is always...
Introduction to business Section D Case study 4 Read the case given below thoroughly and answer...
Introduction to business Section D Case study 4 Read the case given below thoroughly and answer the questions. Sara has been working at a handicrafts factory for about two years. One day she had a fight with her production supervisor Nasser who is responsible for 50 workers under his supervision. Nasser was under stress and found it very difficult to control quality with this big number of workers. Sara made a mistake while packaging the products so he shouted at...
1. Survey results on the Age and Marital Status of women are given below. Use the...
1. Survey results on the Age and Marital Status of women are given below. Use the data to answer the questions.                                                        AGE                       18 to 24       25 to 64       65 and over total Married           3,046           48,116        7,767               58,929 Never Married 9,289             9,252           768               19,309 Widowed               19            2,425          8,636             11,080 Divorced             260            8,916          1,091              10,267 total               12,614            68,709        18,262             99,585 A. What is the probability of a randomly selected woman being Widowed? B. What is the probability of a randomly selected woman...
1. Survey results on the Age and Marital Status of women are given below. Use the...
1. Survey results on the Age and Marital Status of women are given below. Use the data to answer the questions.                                                        AGE                       18 to 24       25 to 64       65 and over total Married           3,046           48,116        7,767               58,929 Never Married 9,289             9,252           768               19,309 Widowed               19            2,425          8,636             11,080 Divorced             260            8,916          1,091              10,267 total               12,614            68,709        18,262             99,585 A. What is the probability of a randomly selected woman being Widowed? B. What is the probability of a randomly selected woman...
Section 1 (3 marks: You can start this section after Week 4 lecture) Read the following...
Section 1 (3 marks: You can start this section after Week 4 lecture) Read the following article: Harford, T. (2014), ‘Big data: A big mistake?’, Significance 11(5), 14–19. Question: Critically evaluate the main points of the article using three bullet points, in less than 150 words in total. Critical evaluation means • To give your opinion on something • To support your opinion (with evidence where possible). • Note: Critiquing is NOT simply stating that something is “bad”. • Weigh...
The results of a tensile experiment on a metal is given in the table below. The...
The results of a tensile experiment on a metal is given in the table below. The tensile sample had circular cross section with the diameter of 10 mm and initial gauge length of 60 mm. Use this table and calculate: Force (N) Measured Length (mm) Region 0 60 Elastic 15708 60.15 Elastic 31416 60.3 Elastic 35343 60.6 Plastic 36128 61.2 Plastic 36914 63 Plastic 37306 66 Plastic (a) The Young modulus of this metal (in GPa) (b) The modulus of...
ADVERTISEMENT
ADVERTISEMENT
ADVERTISEMENT