Question

In: Economics

PART; What would you expect economist to predict would be the impact on your life relative...

PART; What would you expect economist to predict would be the impact on your life relative to the solar power industry if there were no off shore drilling and no importation of foreign oil?(Hint: The combination of these two changes would reduce the supply of oil in the United States by about 70%)

PART 2: Digging Deeper When disaster strikes, you can count on two things: Looting and Price Gouging. Consider that a major hurricane has struck. Power is out, chaos has ensued. Explain what might happen in terms of the supply of essential goods, such as food and gas. Then discuss how price gouging might result. Compare and contrast price gouging with looting.

Solutions

Expert Solution

Solar panel prices will respond in relation to the forces of supply and demand as explained before

When there is only the use of the solar panels the price of the panels will respond in relation to supply and demand and for the oil because it is not supplied then the prices will be expected to rise since there will be demand for the oil while the supply for the oil has been cut short which will impact people greatly.

When a disaster occurs a supply chain disruption is expected whereby the goods will not be delivered in time and the price is expected to hike. The business is expected to lose sales and market share due to the supply chain disruption which is disadvantageous to the business.

In the case of price gauging it might result whereby the seller had stocked essential goods and when a disaster occurs it will be very hard to get other goods due to the disruption in the supply chain and this might result into hiking the prices of the goods. It might also result to hiking of price of supply for few suppliers who can access the market.

In gauging you sell the goods at higher prices than usual while in looting you take advantage of a situation and steal goods from those affected. All cases might be similar in that both are willing to satisfy their self-interests.


Related Solutions

Question 4 Part A: If you were to extract your own DNA would you expect it...
Question 4 Part A: If you were to extract your own DNA would you expect it to look different from your plant DNA extract? Why or why not?
As a classical economist or a Keynesian economist, what would you do for the current U.S....
As a classical economist or a Keynesian economist, what would you do for the current U.S. economy?
4. Which of the following responses would an economist expect to result from an increase in...
4. Which of the following responses would an economist expect to result from an increase in interest rates? (x) Thelma puts less money into savings accounts and bonds because a higher interest rate scares her since it is always an indication that the assets are more risky. (y) Since the interest expense on any given loan increases as the interest rate increases, Beatrice decides to purchase a smaller home than she had initially planned because her monthly income is fixed....
Career Development - what would you expect from your company or manager as it relates to...
Career Development - what would you expect from your company or manager as it relates to Career Development? What is your manager's role in the process? What is your role (as an employee) in the process? Do you think companies should provide opportunities or career development to all employees or only those that show potential for growth? Explain your answer.
Twenty economist were chosen randomly, and asked to predict if the national economy would improve during...
Twenty economist were chosen randomly, and asked to predict if the national economy would improve during the next 12 months. Eleven of the economists predicted an improvement, and nine economists predicted a decrease in the economy. Conduct a hypothesis test to determine if there is a difference in the prediction for the national economy during the next 12 months. Use the normal approximation to the Binomial. In addition, assign a “+” sign to “Improvement” and a “-” sign to “Decrease.”...
Twenty economist were chosen randomly, and asked to predict if the national economy would improve during...
Twenty economist were chosen randomly, and asked to predict if the national economy would improve during the next 12 months. Eleven of the economists predicted an increase, and nine economists predicted a decrease in the economy. Conduct a hypothesis test to determine if there is a difference in the prediction for the national economy during the next 12 months. Use the normal approximation to the Binomial. In addition, assign a “+” sign to “Improve” and a “-” sign to “Decrease.”...
As a Keynesian economist, what would you do for the current U.S. economy?
As a Keynesian economist, what would you do for the current U.S. economy?
Which of the following eukaryotic sequences would you predict to have the longest “life-time” (stability) in...
Which of the following eukaryotic sequences would you predict to have the longest “life-time” (stability) in the cytoplasm: Select one: a. 5’ AUGGCCCGGAAACAAAAAAAAAAAAAAAAAAAAAAA 3’ b. 5’GTCACGATCGACTAGATCGACTGACTGACTGCTAGCATACTACTAAAAA 3' c. 5’ GCUAUAACGUGGAAAAAAAAAA 3’ d. 3’GCUCCUCUAUCACUCUACUAAACAAAACAAGUAAAAAAAAAAAAAAAAAAA 5’
What information would you expect to be collected in an auditing tool? What purpose would that...
What information would you expect to be collected in an auditing tool? What purpose would that information serve? What would that information tell you about your network health?
Imagining your life as a bacterium, what would you rather be a heterotroph or an autotroph...
Imagining your life as a bacterium, what would you rather be a heterotroph or an autotroph and how would you obtain your food and benefit the society you live in. Give examples
ADVERTISEMENT
ADVERTISEMENT
ADVERTISEMENT