Question

In: Chemistry

1)         Predict (write the sequences of) the fragments that would be generated from the treatment of...

1)         Predict (write the sequences of) the fragments that would be generated from the treatment of

            the following peptide

Gly-Ala-Trp-Asp-Arg-Lys-Ala-Glu- Gly-Phe-Gln

            with:

            a) trypsin (4 pnts)

            b) chymotrypsin

            c) pepsin

2)         A certain protein has an α-helix which is 18 residues long with the sequence shown below.

            It is known that hydrogen bonding through the backbone H-bond donor/acceptor groups

            stabilizes most of the structure. Show what other interactions would help stabilize the helix

            by drawing lines (or brackets) between the interacting amino acid residues and naming the

            type of interaction involved.

Q         L          A         N         R         Y         R         T         D         L          E          Q         K         W        Q         N         E          P

Solutions

Expert Solution

Trypsin: cleaves peptide chains mainly at the carboxyl side of the amino acids lysine (Lys) or arginine (Arg), except when either is followed by proline

Chymotrypsin: acts on carboxyl side of large hydrophobic amino acid such as tryptophan (Trp), tyrosine (Tyr) and phenylalanine (Phe), Isoleusine, (Ile), Valine (Val), Leusine (Leu)

Pepsin: cleaves on the carboxyl side of phenylalanine, (Phe), Leusine (Leu), tryptophan (Trp), or tyrosine (Tyr)

Step:1 Find out the N and C terminal (amino and carboxy terminal in peptide chain)

Usually we will write peptide chain which starts from N-termianl left to write

N-terminal-----Gly-Ala-Trp-Asp-Arg-Lys-Ala-Glu- Gly-Phe-Gln----C-terminal

Step:2 Now find out the above mentioned amino acid moieties listed for each protease enzyme (trypsin, chymotrypsin and pepsin)

For trypsin: Lys and Arg

So it cleaves the positions marked as X in the peptide series

N-terminal-----Gly-Ala-Trp-Asp-Arg-X-Lys-X-Ala-Glu- Gly-Phe-Gln----C-terminal

After cleavage we resulted in two small chain peptide and one amino acid, those are

Gly-Ala-Trp-Asp-Arg, Lys and Ala-Glu- Gly-Phe-Gln

Apply same concept to other protease also

For Chymotrypsin: Phe, Trp, Tyr, Ile, Val, Leu

N-terminal-----Gly-Ala-Trp-X-Asp-Arg-Lys-Ala-Glu- Gly-Phe-X-Gln----C-terminal

We get Gly-Ala-Trp, Asp-Arg-Lys-Ala-Glu- Gly-Phe and Gln

For Pepsin: Phe, Leu, Trp, Tyr

N-terminal-----Gly-Ala-Trp-X-Asp-Arg-Lys-Ala-Glu- Gly-Phe-X-Gln----C-terminal

We get Gly-Ala-Trp, Asp-Arg-Lys-Ala-Glu- Gly-Phe and Gln


Related Solutions

Which of the following eukaryotic sequences would you predict to have the longest “life-time” (stability) in...
Which of the following eukaryotic sequences would you predict to have the longest “life-time” (stability) in the cytoplasm: Select one: a. 5’ AUGGCCCGGAAACAAAAAAAAAAAAAAAAAAAAAAA 3’ b. 5’GTCACGATCGACTAGATCGACTGACTGACTGCTAGCATACTACTAAAAA 3' c. 5’ GCUAUAACGUGGAAAAAAAAAA 3’ d. 3’GCUCCUCUAUCACUCUACUAAACAAAACAAGUAAAAAAAAAAAAAAAAAAA 5’
Part A Predict the structures of the most abundant fragments observed in the mass spectrum of...
Part A Predict the structures of the most abundant fragments observed in the mass spectrum of 2-methylpentane. Draw the molecule on the canvas by choosing buttons from the Tools (for bonds), Atoms, and Advanced Template toolbars, including charges where needed. The single bond is active by default. Your answer should include two fragments. Part B Predict the structures of the most abundant fragments observed in the mass spectrum of 3-methylhex-2-ene. Draw the molecule on the canvas by choosing buttons from...
Predict the major products from the treatment of acetone with the following: (a) [H+], NH3, (-H2O)...
Predict the major products from the treatment of acetone with the following: (a) [H+], NH3, (-H2O) (b) [H+], CH3NH2, (-H2O) (c) [H+], excess EtOH, (-H2O) (d) [H+], (CH3)2NH, (-H2O) (e) [H+], NH2NH2, (-H2O) (f) [H+], NH2OH, (-H2O) (g) NaBH4, MeOH (h) RCO3H (i) HCN, KCN (j) EtMgBr followed by H2O (k) (C6H5)3P=CHCH2CH3 (l) LiAlH4 followed by H2O PLEASE SHOW ALL STEPS. THANK YOU.
Why are the peptide fragments generated by trypsin digestion incompatible with C-terminal sequencing using carboxypeptidase A?
Why are the peptide fragments generated by trypsin digestion incompatible with C-terminal sequencing using carboxypeptidase A?
Design a low rate trickling filter for secondary treatment of sewage generated from 10,000 persons with...
Design a low rate trickling filter for secondary treatment of sewage generated from 10,000 persons with rate of water supply 170 liters per capita per day. The BOD5 after primary treatment is 110 mg/L and BOD5 of final effluent should be 20 mg/L. Consider the following equation, where C = 5.358. (St/So)=(1)/(1+C((D^0.67)/(QL^0.5)) Now, design a high rate trickling filter for the data given above except effluent BOD5 is 40 mg/l since polishing treatment is provided after high rate trickling filter....
How many fragments would be produced from trypsin digestion if all the positively charged residues in...
How many fragments would be produced from trypsin digestion if all the positively charged residues in the heparin-binding region of hFGF-1 (FVGLKKNGSCKRGPRTHYGQK) were replaced with negatively charged residues?
After restriction digestion of a DNA molecule, following fragments were generated - 500 bps, 350 bps,...
After restriction digestion of a DNA molecule, following fragments were generated - 500 bps, 350 bps, 100 bps and 40 bps. If you load all these fragments on an agarose gel, this fragment_(a)___________ would move farthest and this fragment _(b)___________ would move slowest under the influence of electricity? (a)500 bps, (b) 40 bps (a) 40 bps, (b) 350 bps (a) 40 bps, (b) 500 bps (a) 100 bps, (b) 350 bps Which of the following statements about STRs is False?...
1. A researcher would like to predict the dependent variable YY from the two independent variables...
1. A researcher would like to predict the dependent variable YY from the two independent variables X1X1 and X2X2 for a sample of N=15N=15 subjects. Use multiple linear regression to calculate the coefficient of multiple determination and test the significance of the overall regression model. Use a significance level α=0.05α=0.05. X1X1 X2X2 YY 66.4 76.4 58 34.6 39 65.5 32.7 23.1 65.8 44.4 71.2 73.3 57.3 50.8 57.9 32.7 48 74.6 53.3 51.4 64.4 48.3 51.1 59.2 66.9 81.4 59.4...
how would you use randomly generated numbers to find 30 random numbers from 1 to 500?
how would you use randomly generated numbers to find 30 random numbers from 1 to 500?
A linear regression model is generated to predict the daily increase in covid 19 cases in...
A linear regression model is generated to predict the daily increase in covid 19 cases in Mumbai . y=2 X1 + 10 X2 + b(100) where Y= number of new cases daily, X1= no of incoming passenger flights in Mumbai, and X2= no of passenger train arriving in Mumbai; b= constant or predicted daily increase due to community transmission ,even if no passenger flight or trains are allowed into the city . Assume a1 and a2 are regression coefficeint for...
ADVERTISEMENT
ADVERTISEMENT
ADVERTISEMENT