In a common allotrope of elemental crystalline arsenic, each arsenic atom forms covalent bonds to three...

In a common allotrope of elemental crystalline arsenic, each arsenic atom forms covalent bonds to three other atoms in a puckered sheet such that the molecular geometry around each atom of arsenic is trigonal pyramidal. Which of the following is most likely the reason for this?

Select the correct answer below:

(A) Each arsenic atom is sp2-hybridized.

(B) Arsenic has an unoccupied d-orbital.

(D) There are two lone pairs of electrons in arsenic's valence shell.

Solutions

Expert Solution

queen_honey_blossom answered 1 year ago

Next > < Previous

Related Solutions

In AX3, the central atom A forms three single covalent bonds and has two lone pairs....

In AX3, the central atom A forms three single covalent bonds and has two lone pairs. What is the molecular geometry of the molecule? What will be molecular geometry if A has three lone pairs? Why? Predict whether the molecule is polar or nonpolar in both these cases. What type of hybridization will the central atom undergo when A has three lone pairs in the molecule described in (a) above? Can hybridization explain the paramagnetic behavior of molecules? Justify your...

8-The _________ form the surface of an atom and participate in forming covalent bonds. a. neutrons...

8-The _________ form the surface of an atom and participate in forming covalent bonds. a. neutrons and electrons b. protons c. neutrons d. protons and neutrons e. electrons 10-Failure of cell cycle check points can cause ________. a. Increased chance of cancer b. Increased mutation rates c. Benign tumors d. All of these e. Unregulated cell division 11-Which is the lowest level of biological organization that shows the emergent property we consider “life”? a. Population b. Cell c. Community d....

Based on the octet rule you would expect a carbon atom to make _ covalent bonds while an oxygen atom would make __covalent bonds.

Based on the octet rule you would expect a carbon atom to make _____ covalent bonds while an oxygen atom would make ______covalent bonds. Fill in the blanks with the answer choices that correctly complete the sentence. a) 4 ; 2 b) 2 ; 4 c) 2 ; 2 d) 4 ; 3 e) 8 ; 8

Refer to Figure 12.9, in the following polar covalent bonds which atom would be labeled with...

Refer to Figure 12.9, in the following polar covalent bonds which atom would be labeled with the δ+ (delta positive) and which atom would be labeled with the δ- (delta negative) notation. The Electronegativities of several elements are below. H = 2.1 C = 2.5 N = 3.0 O = 3.5 F = 4.0 Si = 1.8 P = 2.1 S = 2.5 Cl = 3.0 As = 2.0 Se = 2.4 Br = 2.8 Te = 2.1 I =...

Problem 4.38 Show the direction of polarity for each of the covalent bonds in each of...

Problem 4.38 Show the direction of polarity for each of the covalent bonds in each of the following compounds using the δ+/δ− notation. Part A C−H δ+C−Hδ− δ−C−Hδ+ Part B C−Cl δ+C−Clδ− δ−C−Clδ+ Part C Si−Li δ+Si−Liδ− δ−Si−Liδ+ Part D Si−Cl δ+Si−Clδ− δ−Si−Clδ+ Part E N−Cl δ+N−Clδ− δ−N−Clδ+ Part F N−Mg δ+N−Mgδ− δ−N−Mgδ+

1. Types of Bonds. Are the bonds in each of the following ionic, non-polar covalent, or...

1. Types of Bonds. Are the bonds in each of the following ionic, non-polar covalent, or polar covalent? Arrange the substances with polar bonds in order of increasing bond polarity. a. KBr (s) b. S8 (s) c. HCl (g) d. Cl2 (g) e. CO (g)

Write two resonance structures of C3H3− ion. Mention the formal charge of each atom. A covalent...

Write two resonance structures of C3H3− ion. Mention the formal charge of each atom. A covalent bond has 3.15% ionic character. If the experimental value of the dipole moment were found to be 0.22 D, what would be the length of the covalent bond in picometer?

1.Why are non-covalent bonds important in biological systems? List at least three examples of non-covalent interactions....

1.Why are non-covalent bonds important in biological systems? List at least three examples of non-covalent interactions. 2. You want to amplify at least the underlined sequence, you can have some flanking sequence as well. 5’CTGCTACGTACTGGATGACTGACTGTGATGATCTGATCCCAGTGCTCGTAGTCGTGCGTTCGTAATATATAGCGATGGCGCGATGCGATGCGCGTAGCGGCTAGGCGTAGGCGGATTCGGCTAGGCGATGGCGATGGCGATGCGATATTCTAGCGCTAGCGATGAGGTGATTATATCGGCGCTAGCTGATCGTAGCTGATCG 3’ Design the most optimal primers according to Tm and length. Write out each primer and show which is the 5’ and 3’ end of each primer. How big will your PCR product be? 3.. What are the differences between covalent bonds and non-covalent...

Indicate the direction of polarity of each of the covalent bonds by placing the appropriate delta...

Indicate the direction of polarity of each of the covalent bonds by placing the appropriate delta notation next to each end of the bond. C-O, O-CL, O-F, C-N, C-L, S-H, S-CL

write the bond order for covalent bonds in each of the molecules: SiO2 TeO2

Subjects