Which of the following single nucleotide changes on the DNA's coding strand would be expected to...

Which of the following single nucleotide changes on the DNA's coding strand would be expected to have no effect on the protein level?

A. GTT change to GCT

B. TAA change to TAC

C. ATG change to ATA

D. CAA change to GAA

E. AGT change to AGC

Expert Solution

Which of the following single nucleotide changes on the DNA's coding strand would be expected to have no effect on the protein level?

E. AGT change to AGC

AGT as well as AGC code for amino acid Serine, hence if AGT is changed to AGC, there will be no effect on protein sequence. Thus, it is a silent mutation. On the other hand, GTT codes for valine and GCT codes for Alanine. TAA is a stop codon, while TAC codes for Tyrosine. ATG is the initiation codon and codes for methionine, while ATA codes for Isoleucine. CAA codes for Glutamine and GAA codes for glutamic acid. Hence, all these changes except for option E will change the resulting protein sequence.

gladiator answered 2 years ago

Describe how a single nucleotide insertion in the coding sequence of a gene would affect the...

Describe how a single nucleotide insertion in the coding sequence of a gene would affect the production of the protein (polypeptide) the gene encodes.

Would you be more likely to find single nucleotide polymorphism in the protein-coding or in the...

Would you be more likely to find single nucleotide polymorphism in the protein-coding or in the noncoding dna of the human genome? Please explain, I do not understand the key.

What type of mutation would occur from a single nucleotide deletion (point mutation) within the coding...

What type of mutation would occur from a single nucleotide deletion (point mutation) within the coding sequence of a protein-coding gene? a. a frameshift mutation b. a silent point mutation c. a nonsense point mutation d. a missense point mutation e. All of the choices are possible.

Explain the basis of complementary base paring. Given the nucleotide sequence of a single strand of...

Explain the basis of complementary base paring. Given the nucleotide sequence of a single strand of DNA (below), write the sequence of the complementary strand indicating the appropriate 5' and 3 " ends.

Define the following terms (a) leading strand (b) lagging strand (c) template strand (d) coding strand

The codon in the DNA coding strand has the following sequence: 5' - TAC -3' Which...

The codon in the DNA coding strand has the following sequence: 5' - TAC -3' Which of the following codons (result of a mutation) represents a non-sense mutation? Select one: a. TAA b. TAT c. TTC d. TCC

The following is the nucleotide sequence of a strand of DNA from E. coli. CGTCCTCCAATCGCCCGTACCGTCTCCAGCGGAGATCTTTTCCGGTCGCAACTGAGGTTGATCAAC The...

The following is the nucleotide sequence of a strand of DNA from E. coli. CGTCCTCCAATCGCCCGTACCGTCTCCAGCGGAGATCTTTTCCGGTCGCAACTGAGGTTGATCAAC The strand is transcribed from left to right and codes for a small peptide. a) Is this the mRNA-like coding strand or template strand? b) Which end is the 3' end and which is the 5' end? c) What is the DNA coding strand sequence of the ORF ? d) What is the sequence of the entire transcript (assume the +1 of transcription begins at...

Question 3: Transcription and Translation Below is the beginning of the coding strand of the protein-coding...

Question 3: Transcription and Translation Below is the beginning of the coding strand of the protein-coding region of the Cdc7 gene in yeast. Note that only the coding strand of the DNA is shown. Please be sure to correctly label the ends of any DNA, RNA or protein sequence written below. 5’ATGACAAGCAAAACGAAGAATATCGATGATATACCTCCAGAAATCAAAGAAGAGATGA TACAGCTCTATCATGATCTACCGGGTATAGAAAATGAATATAAACTCATAGACAAGATC GGTGAGGGAACATTTTCGTCAGTGTATAAAGCCAAAGATATCACTGGGAAAATAATAG3’ A. What is the sequence of the first 10 nucleotides of the template strand? B. What is the sequence of the first 10 nucleotides of the...

learn how to find the nucleotide sequence of the complementary DNA STRAND

Do all SNPs (Single Nucleotide Polymorphisms) cause phenotypic changes? Explain your answer.

Question