Discuse if neuraminidase N2 protein of the ibfluenza A virus could be a Excellent targer for...

Discuse if neuraminidase N2 protein of the ibfluenza A virus could be a Excellent targer for designing durgs that inhibit the virus, as antiviral durgs

Expert Solution

N2 protein cleaves off the terminal sialic acids on the glycosylated HA during virus budding to facilitate virus release. It additionally helps the virus spread through the circulation by further removing sialic acids from the cell surface. Cleavage of terminal sialic acids prevents self-aggregation and ensure the efficient spread of the progeny virus from cell to cell. Otherwise, infection would be limited to one round of replication. It may facilitate viral invasion of the upper airways by cleaving the sialic acid moieties on the mucin of the airway epithelial cells. This also plays a role in the budding of the viruses through its association with lipid rafts during intracellular transport.

Thus this can be an excellent target of the virus control, as the protein interferes with the release of progeny virus from infected cells and can be made effective against all influenza strains.

gladiator answered 1 year ago

What is the Pathobiology of Dengue Virus and Structural- Genetics and protein ?

WHICH EXPERIMENTS COULD BE DONE TO TEST IF A VIRUS COULD BE USED AS A VECTOR...

WHICH EXPERIMENTS COULD BE DONE TO TEST IF A VIRUS COULD BE USED AS A VECTOR FOR A VACCINE ?

1) The spike protein on the surface of SARS-CoV-2 virus particles interacts with the ACE2 protein...

1) The spike protein on the surface of SARS-CoV-2 virus particles interacts with the ACE2 protein on our cells to initiate infection. The protein, TMPRSS2, then cleaves the spike protein allowing the virus to enter the cell. This leads to both cell death via pyroptosis and a widespread inflammatory response that damages the lung infrastructure. Scientists have identified a mutation in the TMPRSS2 gene that reduces viral entry in mice. Infected cells with the tmprss2 mutation make TMPRSS2 protein that...

A person could go to a bank one day and have excellent service, and then return...

A person could go to a bank one day and have excellent service, and then return the next day and have a poor experience. This part discusses the special issues concerning the marketing of services. Explain the Four unique characteristics of services and give Four strategies to overcome each characteristic.

how can a virus encode a protein larger than the size of its genome?

What is the Spike protein found in the SARS-CoV-2 virus? Describe the structure of the S...

What is the Spike protein found in the SARS-CoV-2 virus? Describe the structure of the S protein (quaternary, tertiary, secondary and primary protein layers). Also highlight key domains and features of the structure of the S-protein that are important for its function.

How would modifying the protein determined above affect the transmission and infectivity of the virus? How...

How would modifying the protein determined above affect the transmission and infectivity of the virus? How do your protective antibodies and your immune system recognize a virus? Coronaviruses have a single-stranded RNA genome. How do you think this affects the stability of the viral genome? The coronavirus that causes the common cold and SARSCoV2 are in the same family of viruses, how can their genomes be so different? The protein I identified in previous question was surface glyocprotein. This assignment...

Part A: The following sequence encodes a protein in the virus genome: 5’ tctaaaatgtcagatgtaaagtgcacatcagtagtcttactctcagttttgtaacaactc 3’ 3’...

Part A: The following sequence encodes a protein in the virus genome: 5’ tctaaaatgtcagatgtaaagtgcacatcagtagtcttactctcagttttgtaacaactc 3’ 3’ agattttacagtctacatttcacgtgtagtcatcagaatgagagtcaaaacattgttgag 5’ How many amino acids long is the protein? Part B: A base pair substitution (ie. a point mutation) that introduces a nonsense mutation could be introduced to the sequence encoding the protein in Part A. True/False

Please solve the riddle, how can a virus encode a protein larger than the size of...

Please solve the riddle, how can a virus encode a protein larger than the size of its genome?

62. Whether a virus could cause an infection in an organism would depend on A. whether...

62. Whether a virus could cause an infection in an organism would depend on A. whether the virus can gain entry into the cell. B. the functioning of the host's immune system. C. whether the host is the correct genus and species. D. the ability of the virus to attach to the host cell. E. all of the above. 64. Which of the following is/are FALSE regarding vaccines? A. Vaccines stimulate a secondary immune response. B. Attenuated vaccines contain the...

Question