EG201 HW1 1. List three examples of new complex systems developed in the last 10 years,...

EG201 HW1

1. List three examples of new complex systems developed in the last 10 years, including their names, advanced technology used, and the societal need.

Solutions

Expert Solution

*Emerging technologies are those technical innovations which represent progressive developments within a field for competitive advantage.

1.)Agriculture

Emerging technology	Status	Potential applications	Related articles
Agricultural robot.	Research and development, trial projects
Closed ecological systems.	Research and development, working demonstrators (e.g. Biosphere 2)	Agriculture, scientific research, space colonization	Greenhouse, Biosphere 2, Eden Project, Bioshelter, Seawater greenhouse, Perpetual harvest greenhouse system
Cultured meat	Research and development	Humane, resource-efficient, healthier and cheaper meat.	New Harvest
Vertical farming	Research, development, experiments, and diffusion.	Crop and meat production

2.)Aviation

Emerging technology	Status	Potential applications	Related articles
Neural-sensing headset (trans-cranial neural sensing and characterization).	Research and development	Assisting pilots	Brain–computer interface, neuroprosthetics

3.)Construction

Emerging technology	Status	Related articles
Claytronics	Hypothetical, experiment
Four-dimensional printing	Research and development
Molecular assembler	Hypothetical, experiment	Replicator (Star Trek), Von Neumann universal constructor
Utility fog	Hypothetical, experiment

Ally Wells answered 1 year ago

Next > < Previous

Related Solutions

1.Why are non-covalent bonds important in biological systems? List at least three examples of non-covalent interactions....

1.Why are non-covalent bonds important in biological systems? List at least three examples of non-covalent interactions. 2. You want to amplify at least the underlined sequence, you can have some flanking sequence as well. 5’CTGCTACGTACTGGATGACTGACTGTGATGATCTGATCCCAGTGCTCGTAGTCGTGCGTTCGTAATATATAGCGATGGCGCGATGCGATGCGCGTAGCGGCTAGGCGTAGGCGGATTCGGCTAGGCGATGGCGATGGCGATGCGATATTCTAGCGCTAGCGATGAGGTGATTATATCGGCGCTAGCTGATCGTAGCTGATCG 3’ Design the most optimal primers according to Tm and length. Write out each primer and show which is the 5’ and 3’ end of each primer. How big will your PCR product be? 3.. What are the differences between covalent bonds and non-covalent...

1. A company has three new project ideas that are all expected to last 4 years....

1. A company has three new project ideas that are all expected to last 4 years. Unfortunately due to a resource constraint they can only pursue 2 of these projects. Assume the development costs for all projects are paid up front (i.e. prior to the start of the project). The specific financial projections for the three projects are: · Project 1 – Development cost would be $50,000. Projected revenues from the project are $50,000 in the first year with an...

GnuYak Industries is considering a new project that will last for three years. This project requires...

GnuYak Industries is considering a new project that will last for three years. This project requires an initial investment in a machine that costs £90,000 immediately (year 0) and will be depreciated in straight line over its three-year life to a residual value of 0. The management expects this project will result in sales of £100,000 and cost of goods sold will be 50% of sales each year. This project also requires a total net working capital of £10,000 in...

Epiphany Industries is considering a new capital budgeting project that will last for three years. Epiphany...

Epiphany Industries is considering a new capital budgeting project that will last for three years. Epiphany plans on using a cost of capital of 12% to evaluate this project. Based on extensive research, it has prepared the following incremental cash flow projections: Year 0 1 2 3 Sales (Revenues in $) 100,000 100,000 100,000 - Cost of Goods Sold (50% of Sales) 50,000 50,000 50,000 - Depreciation 30,000 30,000 30,000 = EBIT 20,000 20,000 20,000 -...

The accompanying dataset shows the monthly number of new car sales in the last three years....

The accompanying dataset shows the monthly number of new car sales in the last three years. Develop a multiple regression model with categorical variables that incorporate seasonality for forecasting sales. Data Month Year Units Jan 1 39,830 Feb 1 40,101 Mar 1 47,460 Apr 1 47,317 May 1 49,231 Jun 1 51,499 Jul 1 46,486 Aug 1 45,220 Sep 1 44,820 Oct 1 47,009 Nov 1 42,181 Dec 1 44,206 Jan 2 42,247 Feb 2 45,442 Mar 2 54,095 Apr ...

Epiphany Industries is considering a new capital budgeting project that will last for three years. Epiphany...

Epiphany Industries is considering a new capital budgeting project that will last for three years. Epiphany plans on using a cost of capital of 12% to evaluate this project. Based on extensive research, it has prepared the following incremental cash flow projections: Year 0 1 2 3 Sales (Revenues) 100,000 100,000 100,000 - Cost of Goods Sold (50% of Sales) 50,000 50,000 50,000 - Depreciation 30,000 30,000 30,000 = EBIT 20,000 20,000 20,000 - Taxes (35%) 7000 7000 7000 =...

1. Explain the similarities and differences between job-order costing systems and process costing systems. List three...

1. Explain the similarities and differences between job-order costing systems and process costing systems. List three American companies that would likely use a job-order costing system and three other companies that would likely use a process costing (you can list manufacturing and/or service companies). Explain your answer (why do you think these companies would be using such costing systems?)

List three examples of a money market instrument.

List three types of political systems and define each.

1. List at least three examples that fit the definition of aggression, and at least one...

1. List at least three examples that fit the definition of aggression, and at least one that does not. (Examples can be hypothetical or real) 2. Why do people deny the harmful effects of violent media when the research evidence linking violent media to aggression is so conclusive? 3. Consider the various causes of aggression described in this module and elsewhere, and discuss whether they can be changed to reduce aggression, and if so how

Subjects