Question

In: Biology

64. Computationally predicting protein structure from a sequence may involve a “homology modeling” approach and/or “ab...

64. Computationally predicting protein structure from a sequence may involve a “homology modeling” approach and/or “ab initio” techniques such as fragment assembly. Describe how both evolutionary data and knowledge of physico-chemical principles / force fields are used in predicting the structure adopted by a protein sequence.

Solutions

Expert Solution

A protein sequencing a generally performed by combination of both, in silico information and simulation as well as comparative physico-chemical behavior with respect to other proteins. In this regard, the example of enzyme rennet can be taken for understanding. We known that rennet is a peptidase found in the stomach of the calves. Humans also contain gastric peptidase but they get deactivated or down-regulated generally after 10-15 years of age. However, the rennet in the calves remains active for their life time.

In order to understand the structural features of rennet and human peptidase called pepsin, their structural composition and geometry is first matched along with their numerous biochemical properties such as size, moelcular weight, optimum pH for their activation, stability etc. This forms the physico-chemical analysis of the two proteins, where the structure of rennet is required to be known.

Further, the genetic squences of both proteins are fed into an in silico system and allowed to BLAST. The extent of relatedness of these sequences thus represent the evolutionary symmetry or history of these two enzymes. This represents the evolutionary as well as in silico part of the analysis.

Finally, the simulated structural formation and in silico conformation of the two proteins can be matched simultaneously and the specific features of rennet can be demonstrated as compared to pepsin.

This explains the cohesive role of in silico as well as physico-chemical analysis for structural, evolutionary and conformation relatedness between two proteins, or a novel protein.


Related Solutions

The following scenarios involve predicting the location of a stroke from symptoms. For each of the...
The following scenarios involve predicting the location of a stroke from symptoms. For each of the following scenarios involving stroke, indicate on a diagram of the brain (outside side‐view) where the stroke might have occurred.For scenarios 4 and 5, remember that connections involved in sensation and movement are crossed so you have to be careful about the side‐view of the brain you show (left or right hemisphere). 1. Following a stroke, the individual has impaired vision. 2. Following a stroke,...
the aminoacid sequence in protein is referred to as the: primary structure secondary structure pl configuration...
the aminoacid sequence in protein is referred to as the: primary structure secondary structure pl configuration conformation which one?
Topic: Protein Denaturation 1) What are the various levels of organization that any protein structure may...
Topic: Protein Denaturation 1) What are the various levels of organization that any protein structure may have that gives it its 3D shape? Which of these changes during denaturation? 2) For each change made to a protein solution, how might it affect the interactions that are involved in a protein's shape? 3) What is the difference between precipitation of a protein and its denaturation? How might you tell the difference?
It is possible to make some predictions about protein secondary structure based on the primary sequence....
It is possible to make some predictions about protein secondary structure based on the primary sequence. Consider the following amino acid sequence: 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 Ile-Ala-His-Thr-Tyr-Gly-Pro-Phe-Glu-Ala-Ala-Met-Cys-Lys-Trp-Glu-Ala-Gln-Pro-Asp-Gly-Met-Glu-Cys-Ala-Phe-His-Arg A) Where might Beta-Turns occur? B) Where might intrachain disulfide cross-linkages be formed? C) Assuming that this sequence is part of a larger globular protein, what is the probable...
Below is a segment of coding sequence from the overlapping Ink4A-Arflocus (top line) and protein sequence...
Below is a segment of coding sequence from the overlapping Ink4A-Arflocus (top line) and protein sequence from Ink4A(line 2, zero frame) and Arf(line 3, +2 frame). caggtcatgatgatgggcagcgcccgagtggcggagctgctgctgctccacggcgcggag Q  V  M M  M  G  S  A R  V  A  E  L L  L  L  H G  A  E G  H  D D  G  Q R  P  S G  G  A A  A  A  P  R  R  G -What bases could be used to maintain this Leucine codon in Ink4A but mutate the Proline codon in Arf? - What amino acid codons could be introduced into Arf Proline codon without changing the Ink4A Leucine codon? - What mutant amino acids may...
Question 64 Mutations may be recessive because cells can increase the amount of functional protein produced...
Question 64 Mutations may be recessive because cells can increase the amount of functional protein produced from their remaining normal allele. True False Question 65 For genes which have multiple alleles, the relationships between those alleles can be a variety of types of dominant/recessive relationships. False True
explain the mechanism how the double distilled water may denatured the tertiary structure of protein ?
explain the mechanism how the double distilled water may denatured the tertiary structure of protein ?
explain how the three-dimensional structure of a cytosolic protein differs from a transmembrane protein in terms...
explain how the three-dimensional structure of a cytosolic protein differs from a transmembrane protein in terms of the amino acid distribution and folding.
1.List the basic sequence of cellular events resulting in protein production and export from the cell,...
1.List the basic sequence of cellular events resulting in protein production and export from the cell, beginning at DNA in the nucleus and ending with vesicular exocytosis. Include the following terms and describe what happens at each organelle or cellular structure: ribosomes, mRNA, DNA, rough the endoplasmic reticulum, exocytosis, nuclear pore complex, Golgi complex (cis and trans sides), nucleus, microtubules, vesicle. 2. Be able to label and describe the function of the cellular features of the eukaryotic mitochondria. 3. Be...
Why are protein differ from one another in sugar content and structure ? Give three reasons...
Why are protein differ from one another in sugar content and structure ? Give three reasons why chemical difference affects the 2D gel behaviour of the isoforms present.
ADVERTISEMENT
ADVERTISEMENT
ADVERTISEMENT