Question

Below is a segment of coding sequence from the overlapping Ink4A-Arflocus (top line) and protein sequence from Ink4A(line 2, zero frame) and Arf(line 3, +2 frame).

caggtcatgatgatgggcagcgcccgagtggcggagctgctgctgctccacggcgcggag

Q  V  M M  M  G  S  A R  V  A  E  L L  L  L  H G  A  E

G  H  D D  G  Q R  P  S G  G  A A  A  A  P  R  R  G

-What bases could be used to maintain this Leucine codon in Ink4A but mutate the Proline codon in Arf?

- What amino acid codons could be introduced into Arf Proline codon without changing the Ink4A Leucine codon?

- What mutant amino acids may be substrates for phosphorylation?

Answer 1

In this question last leucine is code by the coded by the CTC codon but proline that overlapping, in other frame is codded by the CCA.

In this question CTC and CCA are overlapping but coding for different amino acid in different frame.

Leucine is coded by the six codons

CTC,TTA,TTG,CTT,CTA and CTG

Here proline can be coded by CCA, CCC, CCG and CCT hence it cannot change by the third base or 50^th base of this sequence hence it second of CCA will need to change.

It will have the following combinations

CGA code for arginine

CAA codes for Glutamine

CTA code for leucine

In third frame CCA is replace by CTA than proline become the leucine but Histidine will become the tyrosine and that will create the site for phosphorylation.