1.) If two DNA strands were aligned parallel to one another, would you see a lagging...

1.) If two DNA strands were aligned parallel to one another, would you see a lagging strand? Why?

2.) Breifly describe how telomeres shorten after DNA replication.

Expert Solution

1). The lagging strand would not form if a DNA molecule with both the strands parallelly aligned to each other undergoes replication.

Explanation: The DNA replication occurs in the 5' to 3' direction on the template. The two strands of a DNA molecule are anti-parallel to each other i.e., one strand 5' --> 3' pairs with the other strand in the direction 3'--> 5'. The replication of the DNA molecule involves replication of one strand in the direction 5'-3' as a continuous leading strand and the other strand is synthesized as discontinuous lagging strands.

2). Telomeres shorten after DNA replication

The formation of a complementary DNA strand on the leading strand by DNA polymerase is easier. However, in the lagging strands, each has a short RNA primer at the replication initiation site. All the RNA primers, except the one on the last Okazaki fragment, are converted to the DNA while repairing. The last RNA primer on the DNA is destroyed by RNases, which also leads to some DNA in the telomere region.

gladiator answered 1 year ago

DNA strands are antiparallel and replication has adapted to accommodate this. If they were parallel, however,...

DNA strands are antiparallel and replication has adapted to accommodate this. If they were parallel, however, would leading and lagging strands be synthesized in the same way they are in antiparallel DNA? Explain. How would the role of DNA ligase change, if at all?

In DNA replication, what is the difference between replicating the leading versus the lagging DNA strands?

What does it mean that the strands of DNA are anti-parallel?

State differences between leading and lagging strands in DNA replication. -enzymes and their functions -Dna directionality...

State differences between leading and lagging strands in DNA replication. -enzymes and their functions -Dna directionality of each strand -Synthesizing a double stranded Dna molecule

1. What would the complementary strand of DNA be for these strands of DNA? (1 point...

1. What would the complementary strand of DNA be for these strands of DNA? (1 point each; 5 points total) a. 5’ – AGCTTGCATGGCTATT – 3’ b. 3’ – GCAATGGGCGCT – 5’ c. 3’ – AAATCCGATGCGCTA – 5’ d. 5’ – GCAGCAGCATTGCA – 3’ e. 3’ – GCAATCGCCGGTGCAC – 5’ 3 During what portion of the cell cycle does DNA replicate? How many times does DNA replicate before mitosis? How many times does DNA replicate before meiosis? (3 points) 4...

1, DNA polymerase a. adds new nucleotides to a strand. b. proofreads DNA strands to see...

1, DNA polymerase a. adds new nucleotides to a strand. b. proofreads DNA strands to see that they are correct. c. makes rare mistakes resulting in mutation. d. is an enzyme. e. is all of thes 2.The three “stop” codons cause what to happen? a. They cause the ribosome to stop building a protein. b. They instruct ribosomes to build proteins. c. They initiate DNA replication. d. They code for three amino acids. 3 True-False. Messenger RNA is the same...

7.Review the structure of DNA. What is meant by a double-stranded structure with complementary anti-parallel strands?...

7.Review the structure of DNA. What is meant by a double-stranded structure with complementary anti-parallel strands? 8. What is the difference between replicating the leading strand and the lagging strand? 9. What is the role of each of the following in DNA replication: origin of replication, helicase, single-strand binding proteins, primase, DNA polymerase III, DNA polymerase I, ligase, and topoisomerase, Okazaki fragments, and telomerase? 10. What problem does the mechanism of DNA replication pose for the ends of linear eukaryotic...

1. Would you expect to see more or less acetylation in regions of DNA that are...

1. Would you expect to see more or less acetylation in regions of DNA that are sensitive to digestion by Dnase I? WHY? 2. Suppose a chemist develops a new drug that neutralizes the positive charges on the tails of histone proteins. What would be the most likely effect of this new drug on chromatin structure? would this drug have any effect on gene expression? explain your answers. I have no idea how to answer these two questions in a...

A double-stranded fragment of viral DNA, one of whose strands is shown below, encodes two peptides,...

A double-stranded fragment of viral DNA, one of whose strands is shown below, encodes two peptides, called vir-1 and vir-2. Adding this double stranded DNA fragment to an in vitro transcription and translation system yields peptides of 10 residues (vir-1) and 5 residues (vir-2). 5’ AGATCGGATCGTCAACTATATGTGATTAACAGAGCATGCGGCATAAACT 3’ Identify the DNA sequence that encodes each peptide Determine the amino acid sequence of each peptide In a mutant viral strain, the T at position 23 has been replaced with a...

1 (a). Describe one fundamental way in which proteins and DNA resemble one another and one...

1 (a). Describe one fundamental way in which proteins and DNA resemble one another and one fundamental way in which they differ from one another. (b). Using the genetic code table provided in lecture (or you can see one here: http://tigger.uic.edu/classes/phys/phys461/phys450/ANJUM02/codon_table.jpg) write the sequence of a mRNA molecule that could encode the following amino acid sequence (for amino acids that are specified by more than one codon, just choose one of the codons; label 5’ and 3’ ends in all...

Question