Question

In: Biology

The five major steps involved in a predation act can be summarised as 1) prey perception,...

The five major steps involved in a predation act can be summarised as 1) prey
perception, 2) prey approach, 3) prey seizure, 4) prey dispatch and 5) prey
consumption. Apply your knowledge of reptiles to explain why snakes are
such successful predators. Use the five steps to structure your answer.

this question is zoology question

Solutions

Expert Solution

Answer :

(1) Prey perception and (2) Prey approach :

  • Snakes can interpret the ground level vibrations using inner ear with cochlea. Vibrations transmitted by jawbones. It help in judging prey movement and location to the snakes.
  • Snakes have heat sensors and which make them capable to catch their prey even in dark .
  • Snakes use their tongues to smell the nearby chemical signals through this they can estimate the prey location and approach to it.

(3) Prey seizure and (4) Prey dispatch :

  • Venomous snakes generally bite the prey and inject the toxic substance inside the prey body and the prey become paralised which later result into its death.
  • Snakes like paython bite the prey without injecting venom and wrap around the prey body, this results into the death of prey due to suffocation.

(5) Prey consumption:

  • Snakes start eating its prey when the prey stop struggling. Due to their loosely connected jaw bones and elastic skin they can swallow a big size prey easily depending upon thei head size.
  • Snakes swallow head part of the prey first.

Related Solutions

Referring to Conflict management, identify the five major steps involved in managing a conflict situation with...
Referring to Conflict management, identify the five major steps involved in managing a conflict situation with the help of an example detailed for each step. Type into the text box below:
Research the necessary steps involved to attain customer value. Apply these steps to your own perception...
Research the necessary steps involved to attain customer value. Apply these steps to your own perception in attaining value.
1)explain the four major steps involved in Hypothesis Testing. which step you feel will be the...
1)explain the four major steps involved in Hypothesis Testing. which step you feel will be the most important to the process and why. 2) Give a real life example of how you might use hypothesis testing.
What steps can an auditor take to maintain their independence and the perception of their independence...
What steps can an auditor take to maintain their independence and the perception of their independence to the shareholders?
Identify and explain the major steps involved in preparing the statement of cash flows.
Identify and explain the major steps involved in preparing the statement of cash flows.
Discuss the major steps involved in the develoment of hpv vaccine. i am looking for an...
Discuss the major steps involved in the develoment of hpv vaccine. i am looking for an essay type long answer with no bullet points
there are typically five steps involved in a standard water treatment process. Identify which of these...
there are typically five steps involved in a standard water treatment process. Identify which of these steps of the water treatment process and describe how they are performed.
Identify and explain the major steps involved in preparing the statement of cash flows. please type...
Identify and explain the major steps involved in preparing the statement of cash flows. please type the answer
1) There are two major tests of readiness for college, the ACT and the SAT. ACT...
1) There are two major tests of readiness for college, the ACT and the SAT. ACT scores are reported on a scale from 1 to 36. The distribution of ACT scores are approximately Normal with mean μ = 21.5 and standard deviation σ = 5.4. SAT scores are reported on a scale from 600 to 2400. The SAT scores are approximately Normal with mean μ = 1498 and standard deviation σ = 316. Jorge scores 1850 on the SAT. Assuming...
Given this segment of a double-stranded DNA molecule, draw the two major steps involved in DNA...
Given this segment of a double-stranded DNA molecule, draw the two major steps involved in DNA replication: ATCGGCTAGCTACGGCTATTTACGGCATAT TAGCCGATCGATGCCGATAAATGCCGTATA
ADVERTISEMENT
ADVERTISEMENT
ADVERTISEMENT