Question

In: Biology

Create a chart that compares the following methods of DNA extraction: Phenol-Chloroform, Chelex, silica-based, and differential....

Create a chart that compares the following methods of DNA extraction: Phenol-Chloroform, Chelex, silica-based, and differential. Include a very short descriptions of each, advantages and disadvantages, and special instances where they may be used.

Solutions

Expert Solution

The various differences, advantages, disadvantages and usability of DNA-extraction methods can be as discussed below:

Method Description Advantage Disadvantage Usability
Phenol-chloroform Based upon differential solubility of different bio-molecules in liquid-liquid interphase Easy to perform, quick and does not require expensive chemicals Low yields, DNA degradation is subjected to handling errors, cross-contamination with RNA, Proteins Commonly used in research labs for massive extraction
Chelex Based upon chelation of bio-molecule on a solid-liquid interface containing chelating agent in ion-exchange chromatography module Cheap, easy and quick. Required expertise in handling and monitoring quality and quantityt of elute, high susceptibility of chelex to DNases Used in labs and colleges frequently
Silica-based Based upon separation of DNA from the sample from a solid-liquid interface by capturing DNA in silica gels by micro-absorption High quality DNA with purity and integrity is obtained. User friendly interface can be created by binding these micropore silica on chips Silica gel columns cost revenue to the researchers Very high purity of DNA from a variety of samples can be obtained
Differential Isolation of DNA from different samples is performed by differential lysis procedures DNA from different samples can be simultaneously extracted without inter-mixing Expert handling and observational efficiency are explicitly required DNA can be isolated from different sources by expertise in multiplexing the protocols

Related Solutions

nutrition-- 1)make a chart that compares the methods for measuring body fat.
nutrition-- 1)make a chart that compares the methods for measuring body fat.
The extraction of DNA is a common procedure in biotechnology research laboratories. Research the methods of...
The extraction of DNA is a common procedure in biotechnology research laboratories. Research the methods of extracting DNA in biotechnology facilities. Describe how the extraction methods used in this lesson compare to those of research laboratories.
1) Create a chart that compares and contrasts the structure of gram-positive and gram-negative cell walls....
1) Create a chart that compares and contrasts the structure of gram-positive and gram-negative cell walls. 2) Gram negative bacteria are considered more harmful than gram positive bacteria.What are the two reasons that contribute to this situation due to the unique characteristic of the outer membrane of Gram-negative bacteria? (Minimum length : 150 words)
For this task you will create a chart describing the different methods of establishing the reliability...
For this task you will create a chart describing the different methods of establishing the reliability of a psychological instrument. In one column write the method (e.g., test-retest method) and on another column write a brief description for each of the methods.
Create a chart comparing and contrasting the replication strategies of DNA viruses, RNA viruses, and reverse-transcribing...
Create a chart comparing and contrasting the replication strategies of DNA viruses, RNA viruses, and reverse-transcribing viruses.
Regarding DNA extraction: 1) Describe the purpose of each of the following steps or reagents used...
Regarding DNA extraction: 1) Describe the purpose of each of the following steps or reagents used in DNA isolation (in detail): - Using fresh vs. dried specimens - Grinding or tearing tissue - Lysis solution - TE buffer
Database Systems Lab Exercises Create a table Faculty based on the following chart: Column Data type...
Database Systems Lab Exercises Create a table Faculty based on the following chart: Column Data type Constraints Faculty_Id Number (6) Primary Key => faculty_pk Last_Name Varchar2(15) Not NULL First_Name Varchar2(15) Not NULL Dept Char(3) Save the SQL statement as ex1.sql. Confirm and validate the creation of the new table. Create a table Dept based on the following chart: Column Data type Constraints Dept_Code Char (3) Primary Key => dept_pk Dept_Name Varchar2(20) Not NULL Save the SQL statement as ex2.sql. Confirm...
Based on the information below, create a project schedule (Gantt Chart). Assign tasks to either Workgroup...
Based on the information below, create a project schedule (Gantt Chart). Assign tasks to either Workgroup or Individual. Project: Vacation Team: "Workgroup 1", "Individual" Start/End: February 19 - May 26 START A. February 19: Vacation participation must be confirmed Time allotted: 7 days i. Confirm participation Time needed: 1 day ii. Research vacation deals Time needed: 1 days iii. Decide on destination Time needed: 2 days iv. Create travel list Time needed: 1 day Slack available: 2 days B. February...
Answer the following questions based on this codingstrand of DNA:                               &nbs
Answer the following questions based on this codingstrand of DNA:                                                                         5’ GGCCATGACAGAGGAGCAAAAGTTATTGCT 3’ Drennan et al. (1996) identified several mutations in this enzyme that result in methylmalonic acidemia (MMA). One of those mutations is a C to A at base pair 1904 in the coding strand of DNA (bold and italicized in the template strand). Write the unique coding strand of DNA for this patient and highlight the change you made. Write it 5’ to 3’. Write the mRNA sequence...
Create a Control Limit chart for the following: You are a manager at RadioTag Inc., a...
Create a Control Limit chart for the following: You are a manager at RadioTag Inc., a maker of RFID tags for US military and private use (e.g., Wal Mart). Your process assembles radio id tags to certain specifications – 95.5 confidence intervals, however as they come off the assembly line a test is run on each tag to determine whether the frequency works or does not (hint the data are dichotomous distributed binary). Below are the data you collected over...
ADVERTISEMENT
ADVERTISEMENT
ADVERTISEMENT