Create a chart that compares the following methods of DNA extraction: Phenol-Chloroform, Chelex, silica-based, and differential....

Create a chart that compares the following methods of DNA extraction: Phenol-Chloroform, Chelex, silica-based, and differential. Include a very short descriptions of each, advantages and disadvantages, and special instances where they may be used.

Solutions

Expert Solution

The various differences, advantages, disadvantages and usability of DNA-extraction methods can be as discussed below:

Method	Description	Advantage	Disadvantage	Usability
Phenol-chloroform	Based upon differential solubility of different bio-molecules in liquid-liquid interphase	Easy to perform, quick and does not require expensive chemicals	Low yields, DNA degradation is subjected to handling errors, cross-contamination with RNA, Proteins	Commonly used in research labs for massive extraction
Chelex	Based upon chelation of bio-molecule on a solid-liquid interface containing chelating agent in ion-exchange chromatography module	Cheap, easy and quick.	Required expertise in handling and monitoring quality and quantityt of elute, high susceptibility of chelex to DNases	Used in labs and colleges frequently
Silica-based	Based upon separation of DNA from the sample from a solid-liquid interface by capturing DNA in silica gels by micro-absorption	High quality DNA with purity and integrity is obtained. User friendly interface can be created by binding these micropore silica on chips	Silica gel columns cost revenue to the researchers	Very high purity of DNA from a variety of samples can be obtained
Differential	Isolation of DNA from different samples is performed by differential lysis procedures	DNA from different samples can be simultaneously extracted without inter-mixing	Expert handling and observational efficiency are explicitly required	DNA can be isolated from different sources by expertise in multiplexing the protocols

gladiator answered 1 year ago

Next > < Previous

Related Solutions

nutrition-- 1)make a chart that compares the methods for measuring body fat.

The extraction of DNA is a common procedure in biotechnology research laboratories. Research the methods of...

The extraction of DNA is a common procedure in biotechnology research laboratories. Research the methods of extracting DNA in biotechnology facilities. Describe how the extraction methods used in this lesson compare to those of research laboratories.

1) Create a chart that compares and contrasts the structure of gram-positive and gram-negative cell walls....

1) Create a chart that compares and contrasts the structure of gram-positive and gram-negative cell walls. 2) Gram negative bacteria are considered more harmful than gram positive bacteria.What are the two reasons that contribute to this situation due to the unique characteristic of the outer membrane of Gram-negative bacteria? (Minimum length : 150 words)

Based on the information below, create a project schedule (Gantt Chart). Assign tasks to either Workgroup...

Based on the information below, create a project schedule (Gantt Chart). Assign tasks to either Workgroup or Individual. Project: Vacation Team: "Workgroup 1", "Individual" Start/End: February 19 - May 26 START A. February 19: Vacation participation must be confirmed Time allotted: 7 days i. Confirm participation Time needed: 1 day ii. Research vacation deals Time needed: 1 days iii. Decide on destination Time needed: 2 days iv. Create travel list Time needed: 1 day Slack available: 2 days B. February...

Answer the following questions based on this codingstrand of DNA: &nbs

Answer the following questions based on this codingstrand of DNA: 5’ GGCCATGACAGAGGAGCAAAAGTTATTGCT 3’ Drennan et al. (1996) identified several mutations in this enzyme that result in methylmalonic acidemia (MMA). One of those mutations is a C to A at base pair 1904 in the coding strand of DNA (bold and italicized in the template strand). Write the unique coding strand of DNA for this patient and highlight the change you made. Write it 5’ to 3’. Write the mRNA sequence...

Create a Control Limit chart for the following: You are a manager at RadioTag Inc., a...

Create a Control Limit chart for the following: You are a manager at RadioTag Inc., a maker of RFID tags for US military and private use (e.g., Wal Mart). Your process assembles radio id tags to certain specifications – 95.5 confidence intervals, however as they come off the assembly line a test is run on each tag to determine whether the frequency works or does not (hint the data are dichotomous distributed binary). Below are the data you collected over...

Create General Ledger entries based on the information given. Chart of accounts: 1001 Cash 1006 Accounts...

Create General Ledger entries based on the information given. Chart of accounts: 1001 Cash 1006 Accounts Receivable 1019 Merchandise Inventory 1124 Office supplies 1125 Store supplies 1128 Prepaid insurance 1163 Office equipment 1164 Accumulated Depreciation - Office equipment 1165 Store equipment 1166 Accumulated Depreciation - Store equipment 2001 Accounts payable 3001 Skip Slider, Capital 3002 Skip Slider, Withdrawals 4013 Sales 4014 Sales discounts 4015 Sales returns and allowances 5002 Cost of goods sold 6012 Depreciation expense - Office equipment 6013...

Based on the chart below, prepare the following: Prepare the following: -An income statement for 2015...

Based on the chart below, prepare the following: Prepare the following: -An income statement for 2015 and 2016 -A balance sheet for 2015 and 2016 -Operating cash flows for the two years -Cash flows from assets in 2016 -Cash flows to creditors for 2016 -Cash flows to stockholders for 2016 2015 2016 Cost of Goods Sold 235,942 297,915 Cash 36,542 51,940 Depreciation 61,056 69,011 Interest Expense 13,877 15,905 Selling and Admin Exp 40,952 58,569 Accounts Payable 32,194...

PYTHON Which of the following are valid ways to create a DNASeq object for the DNA...

PYTHON Which of the following are valid ways to create a DNASeq object for the DNA sequence, GATCGATCGATC? (Select all that apply.) DNA_seq = new Seq("GATCGATCGATC") DNA_seq = Seq(IUPACUnambiguousDNA() ,"GATCGATCGATC") DNA_seq = Seq("GATCGATCGATC") DNA_seq = Seq("GATCGATCGATC", IUPACUnambiguousDNA())

Use the data in the following table to create a fraction nonconforming (p) chart. The column...

Use the data in the following table to create a fraction nonconforming (p) chart. The column of np represents the number of non-conforming units. Is the process in control? (5 points) Sample n np p 1 100 7 0.07 2 100 10 0.10 3 100 12 0.12 4 100 4 0.04 5 100 9 0.09 6 100 11 0.11 7 100 10 0.10 8 100 18 0.18 9 100 13 0.13 10 100 21 0.21 Question 2 A bank's manager...

Subjects