Question

In: Biology

Which one of these is not like the others? (2 pts each) In each set of...

Which one of these is not like the others? (2 pts each) In each set of 3 molecules CROSS OUT one option that does not fit and indicate the correct explanation for why it does not fit the set in the blank. For each set cross out only ONE molecule, and if the same set occurs twice choose a different molecule each time, using a different answer for each blank.

  1. a) Glycogen Amylose

    Amylopectin

  2. b) Chitin

    Cellulose

    Amylopectin

  3. c) Chitin

    Cellulose

    Amylopectin

  4. d) Triacylglycerol

    Sphingolipid

    Glycerophospholipid

  5. e) Triacylglycerol

    Sphingolipid

    Glycerophospholipid

  6. f) Proteoglycan

    Glycoprotein Lectin

_______
_______
_______
_______
_______
_______

Explanations: (not all will be used)

  1. Twohaveα1→4linkages;onehasβ1→4linkages

  2. Twohaveβ1→4linkages;onehasα1→4linkages

  3. Two have α1→6 linkages; one has β1→6 linkages

  4. Twohaveα1→6branches,onedoesnot

  5. TwodoNOThaveα1→6branches,onedoes

  6. Two are made from D-glucose, one is not

  7. Two are easily digestible by most animals, one is not

  8. Two are used for energy storage, one is not

  9. Two are made from glycerol, one is not

  10. Two are made from fatty acids, one is not

  11. Twoaremembranelipids,oneisnot

  12. Two contain protein components, one does not

  13. Two have covalently attached carbohydrates, one does not

Solutions

Expert Solution

a). Amylose is not like Glycogen and Amylopectin because two have α1→6 branches,one doesnot.

In glycogen and amylopectin both, glucose residue at branch point is bonded with first glucose residue of branch by α1→6 glycosidic linkage.

b). Amylopectin is different from Chitin and Cellulose because two have β1→4 linkages; one has α1→4 linkages.

Cellulose is the homopolymer of glucose, in which glucose unit is bonded with each other by β1→4 glycosidic bond and Chitin is a linear homopolymer of N-acetylglucosamine residues bonded with β1→4 glycosidic linkage. Whereas, there is α1→4 linkage in lineaar chain of amyloectin.

c). Amylopectin is different from Chitin and Cellulose because two do not have α1→6 branches,one does.

Cellulose and chitin are linear polysaccharides having β1→4 whereas, amylopectin has α1→6 glycosidic linkage at branch point.

d). Sphingolipid is not like the triacylglycerol and glycerophospholipid two are made from glycerol, one is not.

In triacylglycerol and glycerophospholipid fatty acids (3 fatty acids in triacylglycerol and 2 fatty acid in glycerophospholipid) are attached by ester linkage with glycerol while in sphingolipid fatty acid is attached by ester linkage with sphingosine.

e). Triacylglycerol is not like the sphingolipid and glycerophospholipid because two are membrane lipids, one is not.

Sphingolipid and glycerophospholipid are membrane lipids whereas, triacylglycerol is storage lipid.

f). Lectin is different from proteoglycan and glycoprotein because two have covalently attached carbohydrates, one does not.

In proteoglycans, glycosaminoglycan chains are joined covalently with sulphated protein.

In glycoprotein, one or many oligosaccharides joined covalently with protein.

Lectins are made up of proteins only, lectins bind with carbohydrate with high specificity that's why they are used in cell-cell recognition, cell adhesion and cell signalling.


Related Solutions

13. (10 pts) The address space of a process is the set of addresses to which...
13. (10 pts) The address space of a process is the set of addresses to which it has access. (a) In modern systems, the address spaces of most processes are sparse. What does this mean? (b) Referencing an address not in the address space results in a: (c) Referencing a valid address that is not currently in main memory results in a: (d) Referencing a valid address but without proper permissions (e.g., writing to a read-only location) results in a:...
use R # Problem 4 (5 pts each): # Set x as a vector of 500...
use R # Problem 4 (5 pts each): # Set x as a vector of 500 random numbers from Unif(100,300). # This vector will be kept fixed for the rest of this problem. # # (a) Define a function b1(x, beta0, beta1, sigm) that uses the lm() function to # return the regression line slope b1 for y as a linear function of x, where # # y = beta0 + beta1 x + err # # and the error...
Incorrect Question 2 0 / 2 pts Tests for tuberculosis like all other diagnostic tests are...
Incorrect Question 2 0 / 2 pts Tests for tuberculosis like all other diagnostic tests are not perfect. QFT-G is one of such tests for tuberculosis. Suppose that for the population of adults that is taking the test, 5% have tuberculosis. The test correctly identifies 74.6% of the time adults with a tuberculosis and correctly identifies those without tuberculosis 76.53% of the time. Suppose that POS stands for the test gives a positive result and S means that the adult...
1)One of these Noble Gases is not like the others. (valence e-) Ne Xe Ar He...
1)One of these Noble Gases is not like the others. (valence e-) Ne Xe Ar He K 2) How many “Noble Gas core” electrons (non-valence) does a neutral aluminum atom possess? 13 10 8 3 27 3) Which of the following elements has the greatest attraction for electrons? N C O B 4) Which of the following atoms tend to not obey the Octet Rule? There might be more than one. H C Ba B P 5) A polar molecule...
Question 110 pts Which One (1) of the following traits is not a trait which all...
Question 110 pts Which One (1) of the following traits is not a trait which all vertebrate animals possess or share? Group of answer choices Dorsal, Nerve Chord Four Pentadactyl (five-fingered) appendages or limbs (4 legs or 2 arms and 2 legs) Post-anal tail Notochord or internal support rod Gill Pouches Flag this Question Question 210 pts ___________ is the comparative study of the similarities and differences between similar structures of related organisms. Group of answer choices Molecular Biology Genetics...
Problem Set 2: (10 pts) Research Scenario:Does distraction and/or amount of details affect the ability of...
Problem Set 2: (10 pts) Research Scenario:Does distraction and/or amount of details affect the ability of people to make good decisions? In this fictitious scenario, researchers used a mixed design. Thirty participants were split into two groups – No Distraction or Distraction (n=15 per group). All participants were given TWO scenarios based on amount of details (4 or 12), and were asked to make an objective decision at the end of each scenario. Objective decision was the dependent variable and...
6) (8 pts, 4 pts each) State the order of each ODE, then classify each of...
6) (8 pts, 4 pts each) State the order of each ODE, then classify each of them as linear/nonlinear, homogeneous/inhomogeneous, and autonomous/nonautonomous. A) Unforced Pendulum: θ′′ + γ θ′ + ω^2sin θ = 0 B) Simple RLC Circuit with a 9V Battery: Lq′′ + Rq′ +(1/c)q = 9 7) (8 pts) Find all critical points for the given DE, draw a phase line for the system, then state the stability of each critical point. Logistic Equation: y′ = ry(1 −...
2. (6 pts) Speculate on the effects of each of the following mutations on the translation...
2. (6 pts) Speculate on the effects of each of the following mutations on the translation of the following mRNA. Specifically indicate whether any product would be made, and if so, if it would be altered in any way.  (GpppG is the 5’ cap) 5’GpppGUAACAUGGUCGGACCAUGAC(A)2003’ Mutation that removes the editing pocket from isoleucine-tRNA synthetase. Mutation that prevents GTP hydrolysis of eEF1-a. Mutation that prevents binding of GTP by eEF2.
Problem Solving Set #1 (10 pts each) a. Find the multiplicative inverse of 1234 in GF(4321)...
Problem Solving Set #1 (10 pts each) a. Find the multiplicative inverse of 1234 in GF(4321) using the extended Euclidean algorithm b. Does the multiplicative inverse of 24140 in GF(40902) exist? Prove your answer. c. Is x4 + 1 irreducible over GF(2)? Prove your answer. d. Find (x3 + x + 1)-1 in GF(24 ) mod x4 + x + 1 using the extended Euclidean algorithm e. Find (x3 + x + 1)-1 in GF(28 ) mod x8 + x4...
Answer all definitions. a) [2 pts] Environmental economics b) [2 pts] performance-based standard c) [2 pts]...
Answer all definitions. a) [2 pts] Environmental economics b) [2 pts] performance-based standard c) [2 pts] hedonic price method d) [2 pts] Market Failures e) [2 pts] contingent valuation method
ADVERTISEMENT
ADVERTISEMENT
ADVERTISEMENT