Question

1. How does DNA separate to begin DNA replication vs polymerase chain reaction? What type of bond is broken between the double stranded DNA?

2. Why are primers necessary for the PCR reaction? What size pcr product would you expect if you did not add primers to the PCR reaction? Explain.

3. You are trying to amplify the sequence highlighted below. One of the primers you use is 5’ ATAG 3’. What are the next three nucleotides that are added during the extension step of pcr?

   5’ AGCGCTAATGGGGCCCCTATGC 3’ 3’ TCGCGATTACCCCGGGGATACG 5’

   If you had to design the other primer, what would it be? Make it four nucleotides long and be sure to indicate 5’ and 3’.

Answer 1

In DNA replication process the double stranded DNA is seperated with the enzyme helicase to form a replication fork . Where as in polymerase chain reaction the DNA is seperated due to denaturing process that is increasing the temperature upto 97 where DNA strands are seperated physically.

The bonds are broken during seperation are hydrogen bonds because the nucelotides are bounded with hydrogen bonds that is A=T to one strand of other.

Primers are important for PCR reaction because there is no annealing process done in the template because the taq polymerase only adds the incoming nucleotides with the help of primer sequencial order.No primers no anneling no new strand formation.

There will be no pcr product is formed because ther is no annealing takes place , there is no band appearing in the gel may be we can see the complete genomic DNA in some cases.

5'ATAG3' is a reverse primer where the three nucleotides added after these primer are GGG.

5'CGCT3' is the forward primer used for the given sequence which is used to anneal 5' to 3' direction.