Question

In: Biology

If adenines make up 19% of the bases in the sequence of a fragment of singlestranded...

If adenines make up 19% of the bases in the sequence of a fragment of singlestranded RNA, what can you tell me about the rest of that RNA fragment’s base composition?

Solutions

Expert Solution

According to the Chargaff's rules

We calculated base composition for DNA

[A + U + C + G + C]           =             100 %

[A+G] =             C+T

Here given         A =             19 %,    

So                           T =             19 %

[A+T] =             38 %

[G+C] =             100-38 = 62 %

G = C     =             62/2 = 31 %

For RNA Uracil present instead of Thymine

Result --

A = 19%, T = 19%, G = 31 %, C = 31 %


Related Solutions

Make a write up on half stepper sequence and full stepper sequence on stepper motor control....
Make a write up on half stepper sequence and full stepper sequence on stepper motor control. Differentiate the two, write a summary on findings or results. The motor is driven by TTL logic used to implement the controller. Use 555 timer to operate the controller at 3Hz. Write up to be 6-10 pages
The following sequence is a fragment from the normal version of the Social B gene of...
The following sequence is a fragment from the normal version of the Social B gene of Solenopsis daguerrei ants. You may need to use the codon table provided. DNA SocialB: 5’- ATG TCG GTA GCA TGT GTC TGC-3’ A transition mutation in the sequence results in a change in the 3rd amino acid of the polypeptide chain: Alanine is produced. The DNA sequence with the mutation (the one used to name the SNP 5’ to 3’) is_______. Options - a....
The sequence of nitrogenous bases in an RNA and DNA strand is always written in the...
The sequence of nitrogenous bases in an RNA and DNA strand is always written in the 5? to 3? direction because __________. 1. each strand of RNA or DNA has an unlinked 3? carbon and an unlinked 5? carbon 2. DNA and RNA are synthesized in this direction in cells 3. DNA strands are antiparallel 4. nucleotides are added to the 5? end of the nucleic acid
A DNA string is a sequence of the bases a, c, g, and t in any...
A DNA string is a sequence of the bases a, c, g, and t in any order, whose length is usually a multiple of three. In reality, it is not necessarily a multiple of three, but we will simplify it as such for discussion. For example, aacgtttgtaaccagaactgt is a DNA string with a length of 21 bases. Recall that a sequence of three consecutive letters is called a codon. Assuming the first codon starts at position 1, the codons are...
Pair up the nucleotide bases with their complementary partners.
Pair up the nucleotide bases with their complementary partners. Drag each Item to the appropriate bin.  
Make a detailed trace of the execution of the following program fragment, giving the contents of...
Make a detailed trace of the execution of the following program fragment, giving the contents of all the registers, and memory locations involved. Assume that before execution begins the SS register contains 0410h, and the SP register 0100h, and that the contents of AX, BX, CX, and DX are 789Ah, 0020h, 2000h, and 1234h respectively. SS SP TOS AX BX CX DX Initial contents 0990 0100 / 789A 0020 2000 1234 after PUSH AX after PUSH BX after PUSH CX...
A deletion mutation occurs, leaving 11 bases in nucleotide sequence. What is the maximum number of...
A deletion mutation occurs, leaving 11 bases in nucleotide sequence. What is the maximum number of amino acids that could be coded for by this sequence? Question 8 options: 3 4 6 11 ? Why?
Suppose the DNA bases in a gene sequence follow the distribution: DNA base Probability A 1/3...
Suppose the DNA bases in a gene sequence follow the distribution: DNA base Probability A 1/3 C θ G 1/3 T 1/3 - θ In an experiment, the number of observed bases that are “A” or “C” in a gene sequence is x, and the number of observed bases that are “G” or “T” is y. The EM method is used to find the best value for the parameter θ. Describe the Expectation step for computing the expected numbers of...
Primary sequence of Papain- like protease of Covid-19
Primary sequence of Papain- like protease of Covid-19
can you make me a sample problem of 2 geometric sequence, harmonic sequence, arithmetic sequence so...
can you make me a sample problem of 2 geometric sequence, harmonic sequence, arithmetic sequence so that's all 5 this is for Grade 10 Mathematics all with answers and solutions thankyou
ADVERTISEMENT
ADVERTISEMENT
ADVERTISEMENT