Question

Discuss in details, and in your own words, the steps of protein synthesis. This is a 20 point assignment so answers like "step 1 is transcription and step 2 is translation" are NOT acceptable. Make sure you go into details of each step and use your own words.

Answer 1

The strain of DNA is good for many different proteins. Many codes is a desire for the different proteins, a copy of a small necessary section of DNA is made. The first step of proteins synthesis is -

1) Transcription

m-RNA is made from DNA template. The copying process of DNA is known as transcription. Nucleotides of RNA made with one strand of DNA known as m-RNA, RNA polymerase unzips the DNA and put RNA nucleotides into place. C and G nucleotides match up, A and T nucleotides match up. But any time the RNA places in the complement is places the U and T of the RNA. DNA stand ATCGTACTGATTACACCGTA, the complementary m-RNA stand is UAGCAUGACAAAUGUGGCAU.

This is the collective process by which the generic code is read by enzymes in order to produce all of the protein in an organism. A chromosomes is a very long molecules consisting the many millions of base pairs. In humans gene is 10 to 50 kbp long and when the gene is expressed the specific protein is produced. In transcription enzymes use one of the gene of DNA and produced a messenger RNA. Protein bind to the specific structure called promotor, One of the stand known as template strand or antisense strand and other is non templates strand or sense strand. Elong with the gene the process known as alongation. DNA polmerase synthesis the DNA as move along the strand, RNA polymerase zios DNA back up as it goes. One the RNA polymerase reaches the end of the gene termination occur, An m-RNA has been produced this carries the code in the gene and after the m-RNA will undergo the processing. Genetic materials move into the cytoplasm and known as transcription.

2) TRANSLATION

During translation the m-RNA is code for for a protein, this happens because each m-RNA is codon which code for anticodon and each t-RNA is attached to a specific amino acid and this codon of nucleotide known as readings frame, which is more than enough to code the all protein. Some of the codon is special AUC is start codon and UAC is stop codon. Next t-RNA is coming and sequence continues stop condon is reached and DNA is transcription into m-RNA and this translate into the protein