Arrange the following steps in E. coli translation from first (1) to last (9). Dissociation of...

Arrange the following steps in E. coli translation from first (1) to last (9).

Dissociation of the peptide chain as well as the large and small ribosomal subunits from the complex.

Recruitment of the 50S subunit to form a completed initiation complex in a GTP-dependent manner.

Translocation of uncharged tRNA from P site to E site of the ribosome, and docking of the next charged tRNA at the A site.

A stop codon is encountered at the A site. Peptide bond formation between two adjacent amino acids catalyzed by peptidyl transferase.

Release factor recognizes a stop codon, and the bond between tRNA and the nascent polypeptide chain is broken.

Binding of a charged tRNA to the aminoacyl (A) site of the ribosome complex.

fMet-tRNAfMet recognizes the initiator codon AUG and binds to it.

The small ribosomal subunit binds to the ribosome binding site.

Solutions

Expert Solution

# The small ribosomal subunit binds to the ribosome binding site.

# Recruitment of the 50S subunit to form a completed initiation complex in a GTP-dependent manner.

# fMet-tRNAfMet recognizes the initiator codon AUG and binds to it.

# Binding of a charged tRNA to the aminoacyl (A) site of the ribosome complex.

# Translocation of uncharged tRNA from P site to E site of the ribosome, and docking of the next charged tRNA at the A site.

# A stop codon is encountered at the A site. Peptide bond formation between two adjacent amino acids catalyzed by peptidyl transferase.

# Release factor recognizes a stop codon, and the bond between tRNA and the nascent polypeptide chain is broken.

# Dissociation of the peptide chain as well as the large and small ribosomal subunits from the complex.

gladiator answered 2 years ago

Next > < Previous

Related Solutions

Put the following steps of neurotransmitter signaling in order from first (1) to last (6). The...

Put the following steps of neurotransmitter signaling in order from first (1) to last (6). The first one is shown number in order 1-5 for the rest 1. Action potential reaches the synaptic terminal Vessicles full of neurotransmitter fuse with the plasma membrane. Neurotransmitter is released into the synaptic cleft Neurotransmitters bind to receptors on the dendrite of the receiving neuron. Ion channels on the dendrites of the receiving neuron open and inhibit or trigger an action potential. Neurotransmitters are...

Explain how synthesis of ribosomal proteins in E. coli is regulated at the level of translation.

separation processes for bioproducts from E. coli . Recombinant protein production from E. coli resulted in...

separation processes for bioproducts from E. coli . Recombinant protein production from E. coli resulted in the first products from biotechnology. (a) List the primary structures and components of E. coli that must be removed from a fermentation broth to purify a heterologous protein product (one that differs from any protein normally found in the organism in question) expressed for pharmaceutical use. (b) Identify a sequence of steps to purify a conjugate heterologous protein (a compound comprised of a protein...

Provide detailed descriptions of the events of gene translation. Use E. coli as your model and...

Provide detailed descriptions of the events of gene translation. Use E. coli as your model and include i.) initiation, ii.) elongation, and iii.) termination.

Place the following steps in order, from first to last, in the DNS hierarchical process. Do...

Place the following steps in order, from first to last, in the DNS hierarchical process. Do this by typing the number in front of the step. Do not reorder them. Step Number (Type the number, do not reorder) Step Description Authoritative TLD DNS server gives a referral to the destination domain’s authoritative DNS server. DNS client adds the response to its DNS Resolver Cache. Local DNS server queries an authoritative TLD DNS server. Destination domain’s authoritative DNS server gives the...

The following is the nucleotide sequence of a strand of DNA from E. coli. CGTCCTCCAATCGCCCGTACCGTCTCCAGCGGAGATCTTTTCCGGTCGCAACTGAGGTTGATCAAC The...

The following is the nucleotide sequence of a strand of DNA from E. coli. CGTCCTCCAATCGCCCGTACCGTCTCCAGCGGAGATCTTTTCCGGTCGCAACTGAGGTTGATCAAC The strand is transcribed from left to right and codes for a small peptide. a) Is this the mRNA-like coding strand or template strand? b) Which end is the 3' end and which is the 5' end? c) What is the DNA coding strand sequence of the ORF ? d) What is the sequence of the entire transcript (assume the +1 of transcription begins at...

Arrange the following components of hemostasis in the order in which they occur, from first to...

Arrange the following components of hemostasis in the order in which they occur, from first to last.a)Platelet adhesion, b)Platelet aggregation ,c)Exposed cell wall components, d)Coagulation cascade, resulting in fibrin stabilization of platelet plug ,e)Platelet plug formation,f) Vasoconstriction , g)Vascular damage. plz put them in order a,b,c,d,e,f,g.

Which of the following statements is TRUE? E. coli sigma factors all recognize one E. coli...

Which of the following statements is TRUE? E. coli sigma factors all recognize one E. coli gene Prokaryotic mRNAs contain sequences for sigma factor binding mRNA in both E. coli and humans are translated with the same translation machinery E. coli sigma factors all bind to the core RNA polymerase mRNA always contains the nucleotide sequence encoding just one protein

1. First Describe a toeprint assay involving E. coli ribosomal subunits and a fictious mRNA in...

1. First Describe a toeprint assay involving E. coli ribosomal subunits and a fictious mRNA in a cell-free extract that contains all the factors necessary for translation. a) What results would you expect to see with 30S ribosomal subunits alone? b) With 50S subunits alone? c) With both subunits and all amino acids except leucine, which is required in the 20th position of the polypeptide?

Describes the steps of translation initiation: What is the first tRNA to bind and where does...

Describes the steps of translation initiation: What is the first tRNA to bind and where does it bind? What is the role of IF3? Now describe elongation in prokaryotes - what occupies each of the A, P and E sites during elongation. What are the roles of Ef-Tu and Ef-G? Where is energy spent in the elongation process?

Subjects