Question

In: Computer Science

Suppose you have the following two data sequences: 1101110101100110, and 0101010101010010. What is the value you...

Suppose you have the following two data sequences: 1101110101100110, and 0101010101010010. What is the value you should put in the checksum field if those are the only data you have?

Expert Solution

How To Calculate Checksum :

1) Do the binary addition for all data.

2) Wrap up it there is any carry.

3) Find the 1's complement of the above result.

1 1 1 1 1 1 1 1

1	1	0	1	1	1	0	1	0	1	1	0	0	1	1	0
0	1	0	1	0	1	0	1	0	1	0	1	0	0	1	0

+ --------------------------------------------------------------------------------------------------------------------

0

1

0

1

0

1

0

1

0

^

1--------------------------------------------------------------------------------------------------------------| 1

-----------------------------------------------------------------------------------------------------

0

1

0

1

0

1

0

1

0

1

Now, we have to find its complement. That means, change 1 to 0 and 0 to 1

1

0

1

0

1

0

1

0

1

0

This is the checksum correct option is 3.

I have tried to explain it in very simple language and I hope that I have answered your question satisfactorily. Leave doubts in the comment section if any.

venereology answered 4 months ago

Suppose I have tossed a fair coin 13 times and one of the following sequences was...

Suppose I have tossed a fair coin 13 times and one of the following sequences was my outcome: (1) HHHHHHHHHHHHH; (2) HHTTHTTHTHHTH; (3) TTTTTTTTTTTTT. Demonstrate that prior to actually tossing the coins, the three sequences are equally likely to occur (what is this probability?). What is the probability that the 13 coin tosses result in all heads or all tails? Now compute the probability that the 13 coin tosses result in a mix of heads and tails. Although the chances...

You have sequenced the genomes of males of two fruitfly strains. When comparing the sequences of...

You have sequenced the genomes of males of two fruitfly strains. When comparing the sequences of genes, you found that strain #1 has a gene that’s not present in strain #2. What would you need to do to identify the function of this novel gene? randomly mutagenize the fly embryos of both strains use RNAi to silence the gene in strain #1 and observe the phenotype fuse the gene in strain #1 with GFP and observe the embryo perform a...

1. You have sequenced the genomes of males of two fruitfly strains. When comparing the sequences...

1. You have sequenced the genomes of males of two fruitfly strains. When comparing the sequences of genes, you found that strain #1 has a gene that’s not present in strain #2. What would you need to do to identify the function of this novel gene? randomly mutagenize the fly embryos of both strains perform a forward genetic screen in both strains use RNAi to silence the gene in strain #1 and observe the phenotype fuse the gene in strain...

suppose you have two sets of data to work with.The first set is a list of...

suppose you have two sets of data to work with.The first set is a list of all the injuries that were seen in a clinic in a month's time.The second set contains data on the number of minutes that each patient spent in the waiting room of a doctor's office. Propose your idea of how to represent the key information.To organize your data would you choose to use a frequency table,a culmative frequency table, or avrelative frequency table?Why?

(Subject: Data Structures and Algorithms) Faster merging. You are given two sorted sequences of $\lg{n}$ and...

(Subject: Data Structures and Algorithms) Faster merging. You are given two sorted sequences of $\lg{n}$ and $n-1$ keys. We would like to merge those two sorted sequences by performing $o(n)$ comparisons. (Note we are interested in comparisons, not running time.) Show how this can be done or argue that it cannot be done. Note: In class we showed that ordinary merging would require no more than $\lg{n}+n-1+1= n + \lg{n}$ comparisons.

You have the following data for ABM Corp. The market value of equity is $300M, and...

You have the following data for ABM Corp. The market value of equity is $300M, and the market value of debt is 90M. The company is considering repurchasing its bonds for $20M and issuing common stock for the same amount. This would move beta to 1.29 and after-tax cost of debt to 7%. Estimate new WACC if risk-free rate is 4.7% and the return on stock market is 9.2%. The company pays 22% taxes on its profits.

Suppose you have the following data: Market demand is P = 250 – 5Q

Suppose you have the following data:Market demand is P = 250 – 5QTotal Cost Function is TC = 100 + 5Q+ 3Q2a) If this market has only one firm (monopoly), compute the quantity, price and profit of this firm. Compute PS.b) If this market had many firms (Perfect Competition), compute competitive market output, price, and profit. Compute TS.c). Illustrate your answers in (a) and (b) on the same graph. Your graph should include the demand curve, the MR...

1. What are the main data types in Python? Which data types are sequences? 2. What...

1. What are the main data types in Python? Which data types are sequences? 2. What are some general guidelines for naming a ‘variable’ in Python? Give at least three examples of variable names that follow these guidelines 3. Provide an example of the Python syntax to create a variable to hold the age of a building (for example,40 years old). a. Provide the Python syntax to test whether the variable created above is more than 35, and print the...

What does it mean when two protein sequences have global and local pairwise alignment results that...

What does it mean when two protein sequences have global and local pairwise alignment results that are the same (same identity, similarity, and gap percentages)?

Which of the following eukaryotic sequences would you predict to have the longest “life-time” (stability) in...

Which of the following eukaryotic sequences would you predict to have the longest “life-time” (stability) in the cytoplasm: Select one: a. 5’ AUGGCCCGGAAACAAAAAAAAAAAAAAAAAAAAAAA 3’ b. 5’GTCACGATCGACTAGATCGACTGACTGACTGCTAGCATACTACTAAAAA 3' c. 5’ GCUAUAACGUGGAAAAAAAAAA 3’ d. 3’GCUCCUCUAUCACUCUACUAAACAAAACAAGUAAAAAAAAAAAAAAAAAAA 5’