Question

In: Biology

Read the following paragraph: “The human genome sequence provides the underlying code for human biology. Despite...

  1. Read the following paragraph:

“The human genome sequence provides the underlying code for human biology. Despite intensive study, especially in identifying protein-coding genes, our understanding of the genome is far from complete, particularly with regard to non-coding RNAs, alternatively spliced transcripts and regulatory sequences. Systematic analyses of transcripts and regulatory information are essential for the identification of genes and regulatory regions and are an important resource for the study of human biology and disease. Such analyses can also provide comprehensive views of the organization and variability of genes and regulatory information across cellular contexts, species and individuals. The Encyclopedia of DNA Elements (ENCODE) project aims to delineate all functional elements encoded in the human genome. Operationally, we define a functional element as a discrete genome segment that encodes a defined product (for example, protein or non-coding RNA) or displays a reproducible biochemical signature (for example, protein binding, or a specific chromatin structure).” ENCODE Project Consortium (2012) An integrated encyclopedia of DNA elements in the human genome Nature 489:57074.

Consider the ENCODE definition of gene. What did you learn regarding the diversity of human physiognomy and physiology (both “normal” and pathologies) based on the genetic composition and gene expression in humans?

Solutions

Expert Solution

Gene is a complex unit of DNA. The ENCODE definition of gene is simple, which states that the "discrete genome segment that encodes a defined product or displays a reproducible biochemical signature". This definition covers both protein-coding genes as well as the RNA coding and non-coding but regulatory genes.

  • The complexity arises because the majority of genes in the human body do not code for a protein, they are non-coding or code of RNA, thus involved in regulatory mechanisms.
  • The diversity of human physiology is so vast that gene expressions and functions vary according to body state and pathogenesis - due to alternate splice, regulatory RNA molecules,...etc.
  • Identifying correct genes responsible for physiological activities is important from a health perspective.
  • We need to know and understand the working of pathogenic genes and how they can infect and cause diseases - how pathogenic genes are combined in the human genome and code for pathogenic proteins like in viruses.
  • It is also important to identify the genes involved in the immune response against specific pathogens so that we can design better treatments.

Related Solutions

Describe the hierarchical approach to determining the DNA sequence of the human genome used by the...
Describe the hierarchical approach to determining the DNA sequence of the human genome used by the Human Genome Project (HGP). Your answer should include descriptions of how physical maps were established and how BAC (bacterial artificial chromosome) libraries facilitated sequencing? (Min 2 and a half pages)
A competing commercial effort to sequence the human genome was initiated by the company Celera in...
A competing commercial effort to sequence the human genome was initiated by the company Celera in 1997. How was their approach different from the Human Genome Project? A. Libraries of individual chromosomes were generated and overlapping clones were isolated before sequencing. B. They used sequence tagged sites (STS) and expression sequence tags (EST) to order contigs prior to sequencing. C. They sequenced the entire genome from one female donor. D. They generated overlapping clones from YAC and BAC libraries that...
1.The Human Genome Project succeeded in mapping the human _______ sequence. 2.The conscience clause a federal...
1.The Human Genome Project succeeded in mapping the human _______ sequence. 2.The conscience clause a federal law. True False 3.What specific law does not allow employers to use genetic information to discriminate against employees or applicants applying for jobs? a. Patient Bill of Rights b. Genetic Information Nondiscrimination Act c. Conscience Clause d. Dickey-Wicker Amendment 4.Select all factors from the list that according to Chapter 9, would be considered when matching organ donations with recipients. a. Health of donor and...
Describe the approaches and techniques used to generate the first draft of the human genome sequence...
Describe the approaches and techniques used to generate the first draft of the human genome sequence in Feb 2001? 2 pages min with diagrams . thanks
9. Most of the genes in the human genome code for enzymes. Why? What are the...
9. Most of the genes in the human genome code for enzymes. Why? What are the functions of enzymes?
Part A: The following sequence encodes a protein in the virus genome: 5’ tctaaaatgtcagatgtaaagtgcacatcagtagtcttactctcagttttgtaacaactc 3’ 3’...
Part A: The following sequence encodes a protein in the virus genome: 5’ tctaaaatgtcagatgtaaagtgcacatcagtagtcttactctcagttttgtaacaactc 3’ 3’ agattttacagtctacatttcacgtgtagtcatcagaatgagagtcaaaacattgttgag 5’ How many amino acids long is the protein? Part B: A base pair substitution (ie. a point mutation) that introduces a nonsense mutation could be introduced to the sequence encoding the protein in Part A. True/False
The following are data from a small portion of the genome from four tetrapods. Species: Sequence:...
The following are data from a small portion of the genome from four tetrapods. Species: Sequence: Chelonia mydas GACAG Grus americana GACCG Taricha granulosa GTACA Zaglossus attenboroughi GTCAA The challenge is to reconstruct the evolutionary ancestry of these four species from the molecular sequence information. 1.Phylogeny 1: a. Draw a potential (unrooted) phylogenetic tree illustrating the possible relationships among these species. b. Determine what (minimal) changes in sequence are required and where they must be located on the tree you...
Mark the following as True/False The nuclease Cas9 is encoded by the human genome Proto-oncogenes are...
Mark the following as True/False The nuclease Cas9 is encoded by the human genome Proto-oncogenes are more commonly found in individuals with cancer than in those without cancer The bacterial genome contains viral RNA that protects it from future viral infections Embryonic stem cells express high levels of the “Yamanaka factors”. Beta-amyloid plaques in neurons are associated with Alzheimer’s Disease.
A. Answer Following questions. 1.A large number of class II promoters in the human genome lack...
A. Answer Following questions. 1.A large number of class II promoters in the human genome lack TATA boxes. How does RNA Pol II recruitment differ between promoters with a TATA box and TATA-less promoters (2 pts)? List 2 protein complexes that interact with the CTD of RNA Pol II during transcription 2. What class II gene(s) do not have a polyA tail (1pt)? 3.Polymerase recycling is an important mechanism for achieving high expression levels of a particular gene. What factors...
Q2. Read the paragraph and answer the following (write it down on a paper) "A bottled...
Q2. Read the paragraph and answer the following (write it down on a paper) "A bottled water company want to change how they are selling their product by the traditional method. They want from their customers to have the option to buy from them directly instead of buying their products through Supermarkets or grocery stores". - What are the options the company can take to allow customers to buy directly from them? - How can they create a value to...
ADVERTISEMENT
ADVERTISEMENT
ADVERTISEMENT