Question

In: Computer Science

Question 3 Coding of a video Answer this question using your chosen YouTube video. a) For...


Question 3 Coding of a video
Answer this question using your chosen YouTube video.
a) For the chosen video, is there a lot of temporal redundancy between the frames?
In your opinion, does the temporal redundancy in this video make it possible to obtain a
very high compression? Explain assuming compression with MPEG, as seen in
the lesson.
b) Is the chosen video encoded in progressive format? Explain your answer.
c) (1 point) Does the video contain block effects? Explain why there is presence or
absence of block effects.

Solutions

Expert Solution

1. Temporal redundancy is present when there is large similarity between two successive frames of a video. Yes, for the chosen video , there is a significant temporal redundancy between frames. high compressing a video with lot of temporal redundancy is possible(although other features like spatial redundancy, spectral redundancy etc should also be considered). There are some non-redundant information to which human eyes are quite insensitive. Human eyes do not distinguish between two video sequences one of them encoded at 30 frames per second and the other at 60 frames per second. In addition, they are more sensitive to the variation of luminance than chrominance information. Video encodres exploit this fact .

Starts with an I-frame • Ends with frame right before next I-frame • “Open” ends in B-frame, “Closed” in Pframe – (What is the difference?) • MPEG Encoding parameter, but ‘typical’: – I B B P B B P B B I – I B B P B B P B B P B B I • Why not have all P and B

b. When the video is paused and zoom during motion, and then viewed frame by frame, there appears comb like pattern, suggestiing that the video is interlaced.

c.Yes there is block effect as in cases of high compression ratios, the BDCT method results in the block boundaries being visible in the reconstructed image.


Related Solutions

Question 4 Audio coding Answer this question using your chosen YouTube video. For the chosen video,...
Question 4 Audio coding Answer this question using your chosen YouTube video. For the chosen video, could the sound be encoded efficiently with the predictive encoding method linear (LPC)? Explain your answer.
Successful Business in Arab World Video Watch the Youtube video provided below and answer the questions...
Successful Business in Arab World Video Watch the Youtube video provided below and answer the questions https://www.youtube.com/watch?v=U9XoD9V9Bvg The questions : 1. What are the main factors that can succeed a business in Arab World countries, Provided in the video. ( 1 point ) 2. If you are foreign entrepreneur and decided to start new business in one of these countries , which country you are going to choose , what kind of business, and why ? ( 1 point )
Question 3: Transcription and Translation Below is the beginning of the coding strand of the protein-coding...
Question 3: Transcription and Translation Below is the beginning of the coding strand of the protein-coding region of the Cdc7 gene in yeast. Note that only the coding strand of the DNA is shown. Please be sure to correctly label the ends of any DNA, RNA or protein sequence written below. 5’ATGACAAGCAAAACGAAGAATATCGATGATATACCTCCAGAAATCAAAGAAGAGATGA TACAGCTCTATCATGATCTACCGGGTATAGAAAATGAATATAAACTCATAGACAAGATC GGTGAGGGAACATTTTCGTCAGTGTATAAAGCCAAAGATATCACTGGGAAAATAATAG3’ A. What is the sequence of the first 10 nucleotides of the template strand? B. What is the sequence of the first 10 nucleotides of the...
In the prisoner's dilemma game (watch the video on the youtube, there are plenty of versions...
In the prisoner's dilemma game (watch the video on the youtube, there are plenty of versions of this video available on the Internet), why prisoner's chose to settle for their second best option (they could do better that what most likely would occur). Please explain.
Watch the following video on the video link and then answer the following question. 200 to...
Watch the following video on the video link and then answer the following question. 200 to 250 word minimum per question Video is found on this website link http://www.cnn.com/2017/06/09/health/champions-for-change-child-hunger-in-america/index.html 1. Why are so many American children hungry? Discuss your feelings and thoughts after viewing the video.
A video has been chosen for your enjoyment this week to cover the topic of budgeting....
A video has been chosen for your enjoyment this week to cover the topic of budgeting. Profit planning is an important process for any company. Discuss why a firm prepares a budget and how they analyze the ongoing performance. What advantages does a business have by going through the budget process? Be sure your response is at least 200 words. Video can be found on YouTube: Title- Forecast Accuracy: Is Forecast Variability To Blame Or To Be Exploited? Published on...
2) Create a Data Flow Diagram of Downloading Youtube Video from ?
2) Create a Data Flow Diagram of Downloading Youtube Video from ?
Find a video of a business presentation that includes a PowerPoint presentation on YouTube and analyze...
Find a video of a business presentation that includes a PowerPoint presentation on YouTube and analyze the presentation delivery using information from the textbook.
I have to watch a video on Youtube and then 'develop and defend a typology' based...
I have to watch a video on Youtube and then 'develop and defend a typology' based on that, and write a post. What are different types of Offender typologies??
Watch the YouTube video, link below. Using a demand/supply diagram, explain how reduced milk prices may...
Watch the YouTube video, link below. Using a demand/supply diagram, explain how reduced milk prices may have resulted from: https://www.youtube.com/watch?v=7KPWLSVn0ko&t=90s A dropping worldwide per person milk consumption since 1967. Improved technology in milk production.
ADVERTISEMENT
ADVERTISEMENT
ADVERTISEMENT