Question

In: Chemistry

According to the hard and soft acid and bases indicate with arrow the direction of the...

According to the hard and soft acid and bases indicate with arrow the direction of the favored reaction ,balance the equation and indicate which is a harder or softer acid and harder or softer base.

a)CuCl + LiCH2CH3   ______________   CuCH2CH3 + LiCl

b)KN3 + FeCO3----------K2CO3 + Fe(N3)2

c)Sr(ClO4 )2 + AgI    ----------AgClO4 + SrI2

d)NaCN + FeCl2 ----------NaCl + Na4Fe(CN)6

e) KOCH3 + PdS2O3-------- K2S2O3 + Pt(OCH3)2

Solutions

Expert Solution

Soft acid would bind with a soft base and hard acid would bind with a hard base. Any reaction goes to the preferred binding is favored

a) Favoured in the forward direction.

Li is a hard acid and Cl is a hard base, so going forward we are forming LiCl a hard acid-hard base combination, which is favoured.

Balanced equation : CuCl + LiCH2CH3 --> CuCH2CH3 + LiCl

b) Favoured in the forward direction.

K is hard acid and CO3^2- is a hard base. When going forward we are forming K2CO3 which is favoured.

Balanced equation : 2KN3 + FeCO3 ---> K2CO3 + Fe(N3)2

c) Favoured in the reverse direction, towards the reactant side.

Ag is a soft acid and I is a soft base, where going forward we are breaking the favorable soft acid-soft base combination and hence the reacton would not be favoured.

Balanced equation : Sr(ClO4)2 + 2AgI ---> 2AgClO4 + SrI2

d) Favoured in the forward direction.

Na is a hard acid and Cl is a hard base. When going forward we are forming NaCl which is a hard acid-hard base combination and is thus favoured.

Balanced equation : 6NaCN + FeCl2 ---> 2NaCl + Na4Fe(CN)6

e) Favored in the reverse direction, towards the reactant side.

Pd is a soft acid and OCH3 is a har base. When going forward we are forming the soft acid-hard base combination Pd(OCH3)2 which is not favored and thus reaction will proceed towards the reactant side.

Balanced equation : 2KOCH3 + PdSO3 ---> K2SO3 + Pd(OCH3)2


Related Solutions

1) Draw the curve and indicate with an arrow the direction in which it goes when...
1) Draw the curve and indicate with an arrow the direction in which it goes when t increases. Delete the parameter to find the Cartesian equation. x = 3t-1, y = 2t +1 2)Draw the curve and indicate with an arrow the direction in which it goes when t increases. Delete the parameter to find the Cartesian equation. x= e^t , y = e^(3t)+1
Analyze hard and soft approaches to change management
Analyze hard and soft approaches to change management
pre lab questions: 1. Define “acid” according to the Bronsted-Lowry theory of acids and bases. 2....
pre lab questions: 1. Define “acid” according to the Bronsted-Lowry theory of acids and bases. 2. Hypothesize what might occur to the sodium bicarbonate when it reacts in Part B of this experiment. What will you see? 3. The NaI might undergo one of two different reactions when it reacts with 18 M sulfuric acid in Part C of this experiment. Describe what happens in both of these possibilities (in words or with reaction equations) 4. Lookup the physical appearance...
What is the difference between a soft and hard page fault?
What is the difference between a soft and hard page fault?
Question 1: Using Hard/Soft Acid/Base Concepts (HSAB) please decribe the following a) Dimethylmercury, Hg(CH3)2, is one...
Question 1: Using Hard/Soft Acid/Base Concepts (HSAB) please decribe the following a) Dimethylmercury, Hg(CH3)2, is one of the strongest known neurotoxins. Is it safe to mix mercuric fluoride, HgF2, with methyl lithium, LiCH3? Explain your decision. b) Dimethylmagnesium, Mg(CH3)2, reacts violently with water, while Hg(CH3)2 is remarkably stable in aqueous environment. Explain this observation and provide a chemical equation for the reaction involving Mg(CH3)2.
Indicate the net direction of the dipoles in NF3 and NH3
Indicate the net direction of the dipoles in NF3 and NH3
explain capital rationing -soft rationing with example - hard rationing with example
explain capital rationing -soft rationing with example - hard rationing with example
On the sequence below: 1. Indicate the direction of transcription 2. Indicate which is the coding...
On the sequence below: 1. Indicate the direction of transcription 2. Indicate which is the coding strand and which one is the template for the transcription 3. Write down the mRNA 4. Write down the protein clearly indicating the first codon on the mRNA(hint: find the Kozak sequence RCCAUGG to identify the first codon) 5. Introduce a nonsense mutation 3' AGTCGACTGGCATCAGACTACGCTGTGACTGATACGCGTTTTATTGGATCGCACCGCATACAGGGCCCCGGTACCGTCCAAAACT CCCGAGTAGTCAGATGTCAGCAGCGAAATATACGG 5' 5'TCAGCTGACCGTAGTCTGATGCGACACTGACTATGCGCAAAATAACCTAGCGTGGCGTATGTCCCGGGGCCATGGCAGGTTTTGAGGGCTCATCAGTCTACAGT CGTCGCTTTATATGCC 3'
3.Write the formula for the conjugate acid of each of the following bases. Base: Conjugate acid:...
3.Write the formula for the conjugate acid of each of the following bases. Base: Conjugate acid: HS− HCO3− CO32− HPO42− SO42− Acid Conjugate base (a) HNO2 (b) H2SO4 (c) H2S (d) HCN (e) HCOOH
Whats the outcome of Brexit? Do we know if its Hard, soft, on hold, or no...
Whats the outcome of Brexit? Do we know if its Hard, soft, on hold, or no deal? or do we have to wait more for the outcome?
ADVERTISEMENT
ADVERTISEMENT
ADVERTISEMENT