1) Draw the curve and indicate with an arrow the direction in which it goes when...

1) Draw the curve and indicate with an arrow the direction in which it goes when t increases. Delete the parameter to find the Cartesian equation. x = 3t-1, y = 2t +1

2)Draw the curve and indicate with an arrow the direction in which it goes when t increases. Delete the parameter to find the Cartesian equation. x= e^t , y = e^(3t)+1

Expert Solution

milcah answered 2 years ago

According to the hard and soft acid and bases indicate with arrow the direction of the...

According to the hard and soft acid and bases indicate with arrow the direction of the favored reaction ,balance the equation and indicate which is a harder or softer acid and harder or softer base. a)CuCl + LiCH2CH3 ______________ CuCH2CH3 + LiCl b)KN3 + FeCO3----------K2CO3 + Fe(N3)2 c)Sr(ClO4 )2 + AgI ----------AgClO4 + SrI2 d)NaCN + FeCl2 ----------NaCl + Na4Fe(CN)6 e) KOCH3 + PdS2O3-------- K2S2O3 + Pt(OCH3)2

On the sequence below: 1. Indicate the direction of transcription 2. Indicate which is the coding...

On the sequence below: 1. Indicate the direction of transcription 2. Indicate which is the coding strand and which one is the template for the transcription 3. Write down the mRNA 4. Write down the protein clearly indicating the first codon on the mRNA(hint: find the Kozak sequence RCCAUGG to identify the first codon) 5. Introduce a nonsense mutation 3' AGTCGACTGGCATCAGACTACGCTGTGACTGATACGCGTTTTATTGGATCGCACCGCATACAGGGCCCCGGTACCGTCCAAAACT CCCGAGTAGTCAGATGTCAGCAGCGAAATATACGG 5' 5'TCAGCTGACCGTAGTCTGATGCGACACTGACTATGCGCAAAATAACCTAGCGTGGCGTATGTCCCGGGGCCATGGCAGGTTTTGAGGGCTCATCAGTCTACAGT CGTCGCTTTATATGCC 3'

1. Classify each of the following into which curve is going to shift in which direction?...

1. Classify each of the following into which curve is going to shift in which direction? a. Government decides to take policy to reduce deficit. b. Construction workers goes on a strike for 2 months. c. US dollar depreciates with respect to euro d. People become more optimistic about the economy e. Productivity of U. S workers increase due to technological advancement

Which curve shifts, and in what direction, when the following events occur in the local burrito...

Which curve shifts, and in what direction, when the following events occur in the local burrito shop market? a. College students arrive back into town for the fall semester b. Two more Chipotle restaurants open c. Several pizza shops open

1. What does it mean when a firm "goes local?" a. Draw two sets of supply...

1. What does it mean when a firm "goes local?" a. Draw two sets of supply and demand graphs for a grocery store. Label the first one "standard" and label the second one "local." Illustrate how "going local" shifts supply, demand, or both curves. b. Explain why you drew your graphs the way you did. Note: Oliver's grocery store is just a case study of a grocery store that "goes local" by buying local products to inflate local economy

An increase in the expected price level shifts which curve and in which direction?

An increase in the expected price level shifts which curve and in which direction? aggregate demand curve shifts left. aggregate supply curve shifts right. aggregate supply curve shifts left. aggregate demand curve shifts right.

Refer to Scenario 33-2. Which curve shifts and in which direction?

Scenario 33-2 Imagine that in 2019 the economy is in long-run equilibrium. Then stock prices rise more than expected and stay high for some time. Refer to Scenario 33-2. Which curve shifts and in which direction? a. Aggregate demand shifts left. b. Aggregate supply shifts left. c. Aggregate demand shifts right. d. Aggregate supply shifts right

*Make sure to draw a normal distribution curve to indicate the position and range of Z....

*Make sure to draw a normal distribution curve to indicate the position and range of Z. 1. Let X~N(10,9). Find P(X<8), P(X ≥ 12), P(2 ≤ X ≤ 10) 2. In each part below, find the value of c that makes the probability statement true; 1) ∳(C) = 0.9463 2) P(IZI ≤ C) = 0.95 3) P(IZI ≤ C) = 0.99 4) P(IZI ≤ C) = 0.05 3. If X~N(80,10²), compute; 1) P(X < 100) 2) P(75 < X < 100) 3)...

7. Consider the market for loanable funds, which curve shifts to which direction if there is...

7. Consider the market for loanable funds, which curve shifts to which direction if there is a decline in production technologies?

Define LM Curve and shoe how it derived? Explain in which direction and why LM curve...

Define LM Curve and shoe how it derived? Explain in which direction and why LM curve shifts when there is: a. An increase in money supply b. A decrease in money supply.

Question