Indicate the net direction of the dipoles in NF3 and NH3

Expert Solution

Ans - In NF3 -

In NF3 Florine (F) is more electronegative than Nitrogen (N), So due to this it will attract or pull the shared pair of electrons toward to it self and this leads to dipole in opposite direction to the resultant dipole due to N-F bond hence due to this the net dipole decreases or you can also say that the resultant vector decreases due to this phenomena. But the effect of Florine group is not enough to change the over all or net dipole of compound.

In NH₃ -

Hydrogen group (H) is less electronegative than Nitrogen (N) due to this Nitrogen will attract all shared pair of electrons towards it and due to this the total Dipole increases and is in the direction of Nitrogen.

Diagram-

Ignore the Cutting.

queen_honey_blossom answered 2 years ago

Explain why the dipole moment of NH3 (1.46D) is more than that of NF3 (0.24D)?

Of the following molecules, which is the strongest Lewis Acid? NH3, NF3, NCl, BH3, BF3, BCl3...

Of the following molecules, which is the strongest Lewis Acid? NH3, NF3, NCl, BH3, BF3, BCl3 Please include an explanation with the answer. I am having a really hard time figuring this out.

On the sequence below: 1. Indicate the direction of transcription 2. Indicate which is the coding...

On the sequence below: 1. Indicate the direction of transcription 2. Indicate which is the coding strand and which one is the template for the transcription 3. Write down the mRNA 4. Write down the protein clearly indicating the first codon on the mRNA(hint: find the Kozak sequence RCCAUGG to identify the first codon) 5. Introduce a nonsense mutation 3' AGTCGACTGGCATCAGACTACGCTGTGACTGATACGCGTTTTATTGGATCGCACCGCATACAGGGCCCCGGTACCGTCCAAAACT CCCGAGTAGTCAGATGTCAGCAGCGAAATATACGG 5' 5'TCAGCTGACCGTAGTCTGATGCGACACTGACTATGCGCAAAATAACCTAGCGTGGCGTATGTCCCGGGGCCATGGCAGGTTTTGAGGGCTCATCAGTCTACAGT CGTCGCTTTATATGCC 3'

Explain the importance of dipoles in polymers

Identify whether each of the following compounds exhibits a molecular dipole moment. If so, indicate the direction of the net molecular dipole moment:

Identify whether each of the following compounds exhibits a molecular dipole moment. If so, indicate the direction of the net molecular dipole moment:(a) CH3CH2OCH2CH3 (b) CO2

For each bond, use + and - to show the direction of polarity. Indicate by letter...

For each bond, use + and - to show the direction of polarity. Indicate by letter which bond is expected to be the most polar. (A) Ge - As (B) Ge - Se (C) Se - As The most polar bond is (A,B,C) .

For each of the following independent events, indicate the amounts and direction of effects on the...

For each of the following independent events, indicate the amounts and direction of effects on the elements of the statement of financial position and statement of earnings. Using the following format, indicate + for increase, and - for decrease, and NE for no effect. Also, included the specific account name affected. Transactions: Eg: Rent in the amount of $1,500 is owing to the landlord at year end. 1) Received $400 smart phone bill to be paid next month. 2) Paid $1,800 for...

According to the hard and soft acid and bases indicate with arrow the direction of the...

According to the hard and soft acid and bases indicate with arrow the direction of the favored reaction ,balance the equation and indicate which is a harder or softer acid and harder or softer base. a)CuCl + LiCH2CH3 ______________ CuCH2CH3 + LiCl b)KN3 + FeCO3----------K2CO3 + Fe(N3)2 c)Sr(ClO4 )2 + AgI ----------AgClO4 + SrI2 d)NaCN + FeCl2 ----------NaCl + Na4Fe(CN)6 e) KOCH3 + PdS2O3-------- K2S2O3 + Pt(OCH3)2

Indicate how each of the following will affect the equilibrium concentration of NH3 in the following...

Indicate how each of the following will affect the equilibrium concentration of NH3 in the following reaction: 4NH3(g) + 5O2(g)reverse arrows 4NO(g) +6H2O (g) + 906 Kc There are three possible answers for all questions 1- This will cause an increase in the equilibrium concentration of the reactant NH3 2- This will cause a decrease in the equilibrium concentration of the reactant NH3 3- This will not affect the equilibrium concentration of the reactant NH3 Part E- decrease the volume...

1. Electric Dipoles vs Magnets. Name 2-3 similarities between electric dipoles and magnets in broad terms...

1. Electric Dipoles vs Magnets. Name 2-3 similarities between electric dipoles and magnets in broad terms of forces and motion. Name 1-2 differences between electric dipoles and magnets. 2. Explain the meaning of Magnetic Field Superposition. What is superimposed on what?

Question