all possible elementary events associated with an experiment form?

Expert Solution

solution;

the sample space elementary events are associated with an experment form

A sample space is usually denoted using set notation, and the possible ordered outcomes are listed as elements in the set. ... A subset of the sample space is an event, denoted by E. Referring to the experiment of tossing the coin, the possible events include E={H} and E={T}.

For Example;

orchestra answered 2 years ago

(Probability) List as many different groups of complete events as possible for independent probability experiment of...

(Probability) List as many different groups of complete events as possible for independent probability experiment of your choice.

Let EE and FF be events of an experiment. Select all of the sentences below that...

Let EE and FF be events of an experiment. Select all of the sentences below that are correct. Marks will be deducted for selecting options that are incorrect. Select one or more: a. If EE and FF are mutually exclusive then they must also be independent. b. If EE and FF are independent then Pr(E∩F)=Pr(E)Pr(F)Pr(E∩F)=Pr(E)Pr(F). c. If EE and FF are mutually exclusive then EE and FF can't occur at the same time. d. It is possible for EE and...

In semi strong form hypothesis, what could be possible events which may examine the stock prices...

In semi strong form hypothesis, what could be possible events which may examine the stock prices are adjusted to specific economic event.

Describe the events associated with the ovarian cycle

All business need to be prepared to face any possible events that could disrupt their business...

All business need to be prepared to face any possible events that could disrupt their business and need to have plans to make sure the business can continue to provide service to its customers. For example, if a bank is affected by flood, customers would still need to have access to online banking facilities etc.. The bank cannot say 'Sorry, due to flood we have no online access.' So, for part (b) you need write about the steps an organisation...

Which of the following events are associated with chemiosmosis in chloroplasts? Which of the following events...

Which of the following events are associated with chemiosmosis in chloroplasts? Which of the following events are associated with chemiosmosis in chloroplasts? The pH of the stroma decreases and ATP is hydrolyzed. The pH of the cytoplasm outside the chloroplast decreases and ATP is synthesized. The pH of the thylakoid space increases and ATP is synthesized. The pH of the stroma increases and ATP is synthesized.

In an experiment to determine the effect of nutrition on the attention spans of elementary school...

In an experiment to determine the effect of nutrition on the attention spans of elementary school students, a group of 45 students is divided into three groups of 15, and randomly assigned to each of three meal plans: no breakfast, light breakfast, and full breakfast. Their attention spans, in minutes, were recorded. Say you want to test the hypothesis that the means of the attention spans are not all the same at a level of significance of 5%. (a) (3...

Find all possible pathogen associated molecular patterns (PAMPs) and their respective sensors as a table, including...

Find all possible pathogen associated molecular patterns (PAMPs) and their respective sensors as a table, including cell surface endosomal cytosolic sensors of PAMPs. Include human and mouse in your table. (YOU SHOULD MENTION TLR, NLR, CLR, and RLR)!!!

Identify/highlight all possible palindromic sequences. Which one of these two examples is most likely to form...

Identify/highlight all possible palindromic sequences. Which one of these two examples is most likely to form a hair loop - highlight the hair loop sequence? Example 1: 5' - GCAACTGGATAGCCCTAGAAGGACTAGGGCTTTTCCAAGTCAA - 3' Example 2: 5' - TATTTGCATTCCCTGCAGGGAATCGTTAAGGAGGGCAGTCTTAA - 3'

Describe the possible sources of error in the experiment. How could you improve the experiment?

Question