Question

In: Biology

How does the nucleotide excision repair (NER) system in E. coli work, and what kinds of...

How does the nucleotide excision repair (NER) system in E. coli work, and what kinds of DNA damage does it repair?

Solutions

Expert Solution

Ans-

Nucleotide excision repair will act on the damaged areas of Deoxyribonucleic acid(DNA). In nucleotide excision repair system will cleave the phosphodiester bond on both side of lesion it is generally a thymine dimer which is formed after DNA is exposed to UV radiation. The bond is cleaved on the strand having the thymine dimer which results in excision of short segment of nucleotide called oligonucleotide.
After excision, there is a gap which is filled by the enzyme DNA polymerase and ligated by enzyme Ligase.
For example- Uvr system in E.coli in this oligonucleotide is excised
Enzyme is ABC exinuclease at the site of lesion it will bind to double-stranded DNA. Lesion like thymine dimer.
In this Uvr A and Uvr B will attach to the double stranded DNA at the lesion site. A site where thymine dimer is formed when DNA is exposed to UV radiation.
After this Uvr A will leave and it will allow the Uvr C to come and bind thus forming the dimer of Uvr BC
Now, Uvr BC will cleave the phosphodiester bond at the lesion site and as a result of which a short oligonucleotide sequence is removed.
Uvr D generally the helicase enzyme will unwind the strand of DNA and single strand is released between cuts.
DNA polymerse will now synthesize the nucleotide bases and ligase will join the phosphodiester bond between the bases formed by DNA polymerase.

If you have any doubt ask in comment section. Also, if uh find the answer helpful then please leave a thumbs up?


Related Solutions

With reference to the mechanisms of mismatch repair and nucleotide-excision repair in E. coli cell, which...
With reference to the mechanisms of mismatch repair and nucleotide-excision repair in E. coli cell, which mechanism is more energy costing? Explain your answer.
Describe what happens during nucleotide excision repair, base excision repair, mismatch repair and double-stranded breakage repair...
Describe what happens during nucleotide excision repair, base excision repair, mismatch repair and double-stranded breakage repair of DNA.
Match each DNA repair mechanism with its description. photoactive repair base excision repair nucleotide excision repair...
Match each DNA repair mechanism with its description. photoactive repair base excision repair nucleotide excision repair mismatch repair   SOS system nonhomologous end-joining A. recognizes newly synthesized but improperly paired DNA and nicks the strand to replace B. cuts a piece out of distorted DNA to be filled in by polymerase C. an emergency, error-prone effort to salvage replication of damaged DNA D. removes and replaces depurinated or deaminated bases from sugars E. repairs pyrimidine dimers in the presence of light...
Describe the mechanism underlying the below repair mechanisms. Base Excision Repair Nucleotide Excision Repair Doublestranded Break...
Describe the mechanism underlying the below repair mechanisms. Base Excision Repair Nucleotide Excision Repair Doublestranded Break Repair
In the mismatch repair system, the MutS protein initiates the repair process, and the MutHL excision...
In the mismatch repair system, the MutS protein initiates the repair process, and the MutHL excision complex acts by cutting A) The methylated strand of the double helix B) Any U:A base pairs found in the DNA C) Any G:T base pair D) The non-methylated strand of the double helix E) The site of the helix distortion
The following is the nucleotide sequence of a strand of DNA from E. coli. CGTCCTCCAATCGCCCGTACCGTCTCCAGCGGAGATCTTTTCCGGTCGCAACTGAGGTTGATCAAC The...
The following is the nucleotide sequence of a strand of DNA from E. coli. CGTCCTCCAATCGCCCGTACCGTCTCCAGCGGAGATCTTTTCCGGTCGCAACTGAGGTTGATCAAC The strand is transcribed from left to right and codes for a small peptide. a) Is this the mRNA-like coding strand or template strand? b) Which end is the 3' end and which is the 5' end? c) What is the DNA coding strand sequence of the ORF ? d) What is the sequence of the entire transcript (assume the +1 of transcription begins at...
What are the impacts of E. coli on the US healthcare delivery system and in Georgia...
What are the impacts of E. coli on the US healthcare delivery system and in Georgia in terms of financial burden of the monies spent or costs for treatment?
how does a nucleotide inhibitor of RT work? name an antiviral that is in this category?...
how does a nucleotide inhibitor of RT work? name an antiviral that is in this category? how does a non nucleotide inhibitor of RT work? name an antiviral that is in this category.
How can mutations in the excision repair process be produced from the xeroderma pigmentosum (XP) phenotype?...
How can mutations in the excision repair process be produced from the xeroderma pigmentosum (XP) phenotype? What is the "RNA World hypothesis"? I need digital version of answer not handwriting thx?
What is the incident command system (ICS)? How does it work and why is it a...
What is the incident command system (ICS)? How does it work and why is it a good basis for National Incident Management System in USA
ADVERTISEMENT
ADVERTISEMENT
ADVERTISEMENT