Question

In: Biology

Goal: Portray your knowledge of the important attributes of a particular hominin species. Format:Make Dating profile!...

Goal: Portray your knowledge of the important attributes of a particular hominin species.

Format:Make Dating profile! OF 'Ardipithecus ramidus' HOMINI SPECIES. There are guidelines below. Creativity welcome!

All of the responses on this dating profile should relate to/be unique to the hominin species you choose. There must be good reasons for your answers that relate to the morphology, physiology, behavior, and/or environment of your chosen hominin.

There must be good reasons for your answers that relate to the morphology, physiology, behavior, and/or environment of your chosen hominin.

Required questions:

  1. What are your best physical features and why?
  2. What are your special skills and/or favorite hobbies?
  3. What are you looking for in a partner?
  4. What is your favorite food and how do you like it prepared?
  5. What are you binge-watching right now and why? (Netflix, Hulu, Prime, whatever streaming service)
  6. Describe your perfect first date.
  7. On a typical weekend you will find me...
    1. Example: On a typical weekend, you will find me building a fire in a cave.
  8. What are 5 things you couldn’t live without?
  9. Message me if...
    1. Example: “Message me if your cranial capacity is at least as big as your ego”.
    2. Example: “Message me if you like long muddy walks at Laetoli”

THANKYOU

Solutions

Expert Solution

  1. My best physical features are my nose and eyes because when you first look at me ,you can't get away with my sharp nose and my big eyes because these two features make me look more attractive.
  2. My special skills and/or favorite hobbies are reading novels and listening to music.Special skills are very fast at completing a task that has been assigned to me accurately.
  3. I am looking for three qualities in a partner. Those would be very loving and caring person ,high sense of understanding and encouraging me to take up my career to the next level.
  4. My favorite food is chilli chicken. I like it prepared dried and not as a gravy.
  5. I am binge watching Netflix right now as it offers different and multiple movies based on your choice and they also provide DVDs of the same to deliver to our home.
  6. Perfect first date would be a hill station destination.
  7. On a typical weekend you will find me spending a day at a spa or resort with my favorite people.
  8. 5 things that I couldn’t live without are air, water, oxygen, my family and my job.
  9. Message me if you wish to join me at the musical concert of my favorite singer in Canada

Related Solutions

Why is it important to characterize different strains of a particular species? E. coli, for example.
Why is it important to characterize different strains of a particular species? E. coli, for example.
Discuss your prior knowledge of proposals. (Remember: the goal of a proposal is to inspire change,...
Discuss your prior knowledge of proposals. (Remember: the goal of a proposal is to inspire change, to solve a problem, or address an issue). Answer: Have you ever had to write one? Answer: Do you read them in your profession? Note: If you have never written or read a proposal, locate one online and discuss the merits/drawbacks based on what you have learned.
The final assignment for the course will test your knowledge on one particular area of study...
The final assignment for the course will test your knowledge on one particular area of study in the field of Organizational Behaviour. The topics to choose from are: • Bias in the workplace • Conflict resolution • Organizational culture • Facilitating creativity • Decision making obstacles • Communication in organizations • Job and organizational design • Organizational ethics • Diversity in organizations • Contemporary work environments If you would like to use a different topic, you must request approval from...
Why is it important to randomly select your plots when sampling species diversity?
Why is it important to randomly select your plots when sampling species diversity?
IMPORTANT!!! Please answer it precisely. It is expected to use academic knowledge and language. Use your...
IMPORTANT!!! Please answer it precisely. It is expected to use academic knowledge and language. Use your own words, do not copy paste. Suppose you are a microbiologist living in late 1800ies and early 1900. You suspect that the microorganism called Mycobacterium leprae might be responsible for the disease called leprosy. You had heard about a researcher called Robert Koch and his postulates, and you would like to follow his approach to test if leprosy is caused by Mycobacterium leprae. Explain...
IMPORTANT!!! Please answer it precisely. It is expected to use academic knowledge and language. Use your...
IMPORTANT!!! Please answer it precisely. It is expected to use academic knowledge and language. Use your own words, do not copy paste. Please explain in detail how the microbiology information about the infectious diseases and their epidemiology, aseptic techniques of microbiology (sterilization, disinfection, antimicrobial techniques and agents) helped you during the COVID-19 pandemic. Please give detailed examples of how you used your microbiology and/or scientific knowledge in helping/informing people in your family and/or your community and/or how different was your...
Write a one page essay on how important is it to know your basic accounting knowledge...
Write a one page essay on how important is it to know your basic accounting knowledge to analyze financial statements
Write a one page essay on how important is it to know your basic accounting knowledge...
Write a one page essay on how important is it to know your basic accounting knowledge to analyze financial statements
Using your knowledge of DNA replication, copy the following. Write down all the important steps and...
Using your knowledge of DNA replication, copy the following. Write down all the important steps and players of the reaction. Show the primer location and derive the complimentary strand sequence. 5` - AGATTCTGAGTCGTGACTCGTACGTCATAACTT -3`
Your research goal is to find an important issue facing Canadian society currently. Once you have...
Your research goal is to find an important issue facing Canadian society currently. Once you have found a reputable media source, you are to complete the tasks below that will help you learn to be an analytic reader. Task paste or enter the information listed below: 1. Cite the article you are using in proper APA format. You can find out how to do this here: https://owl.english.purdue.edu/owl/resource/560/01/ 2. Restate the issue concisely in your own words. 3. State the conclusion...
ADVERTISEMENT
ADVERTISEMENT
ADVERTISEMENT