3` - T A T A G A G C A A T T G C...

3` - T A T A G A G C A A T T G C T A C G T G T A T C C C G A G A C T C C G T A A – 5`

5` - A T A T C T C G T T A A C G A T G C A C A T A G G G C T C T G A G G C A T T – 3`

The sequence above is showing a gene from, which you must transcribed and translated. The promoter (TATA box) is underlined and the start and stop codons are in BOLD. The intervening codons are highlighted. Make predictions about the following mutations:
1. T is inserted before GTG codon. What’s the resulting protein sequence?
2. A deletion of A occurs in addition to the insertion in a. What’s the resulting protein sequence?
3. Do they have a similar effect on the protein? How do they differ?

Solutions

Expert Solution

gladiator answered 4 weeks ago

Next > < Previous

Related Solutions

Given the following economy: Y = C(Y - T) + I(r) + G C(Y - T)...

Given the following economy: Y = C(Y - T) + I(r) + G C(Y - T) = a + b(Y - T) I(r) = c - dr M/P = L(r,Y) L(r,Y) = eY - fr i. Solve for Y as a function of r, the exogenous variables G and T, and the model's parameters a, b, c, and d. ii. Solve for r as a function of Y, M, P, and the parameters e and f. iii. Derive the aggregate...

Y = C + I + G + NX Y = 18,500; G = 4,000; T...

Y = C + I + G + NX Y = 18,500; G = 4,000; T = 2,000 C = 750 + 3/4 (Y - T) I = 1,000 - 50r CF = 750 - 25r NX = 1,825 - 150ϵϵ (a) In this economy solve for consumption, private and public saving, national saving, investment, the trade balance, the net capital outflow (net foreign investment), the real interest rate and the real exchange rate. (b) The demand of funds for...

Y= C + I + G C= 170 + 0.6( Y-T ) where T= 200+0.2Y I=...

Y= C + I + G C= 170 + 0.6( Y-T ) where T= 200+0.2Y I= 100-4r G=350 ( M/p) d= 0.75Y-6r (Ms/P)= 735 1) What is the new equilibrium level of Y and r if the central bank increases money supply by 8%. 2) What is the new equilibrium level of Y and r if government spending is increased to 500 & central bank increases money supply by 8% 3) What is the new equilibrium level of Y and...

At T = 248 °C the reaction SbCl5(g) SbCl3(g) + Cl2(g) has an equilibrium constant in...

At T = 248 °C the reaction SbCl5(g) SbCl3(g) + Cl2(g) has an equilibrium constant in terms of pressures Kp = 1.07. (a) Suppose the initial partial pressure of SbCl5 is 0.566 atm, and PSbCl3 = PCl2 = 0.908 atm. Calculate the reaction quotient Qp and state whether the reaction proceeds to the right or to the left as equilibrium is approached. Qp = ? Reaction proceeds to the (right or left). (b) Calculate the partial pressures at equilibrium. PSbCl5...

1. Compute for the A + C : T + G ratios of the given DNA...

1. Compute for the A + C : T + G ratios of the given DNA strand in "A" 5' A A C C T A C T C C T G C G T G G G T G T C T T 3' 3' T T G G A T G A G G A C G C A C C C A C A G A A 5' 2. What happens if any of the protein for...

A DNA string is a sequence of the bases a, c, g, and t in any...

A DNA string is a sequence of the bases a, c, g, and t in any order, whose length is usually a multiple of three. In reality, it is not necessarily a multiple of three, but we will simplify it as such for discussion. For example, aacgtttgtaaccagaactgt is a DNA string with a length of 21 bases. Recall that a sequence of three consecutive letters is called a codon. Assuming the first codon starts at position 1, the codons are...

A DNA strand is represented by a string of the characters A, C, G, and T,...

A DNA strand is represented by a string of the characters A, C, G, and T, each of which represents a nucleotide. Each nucleotide has its complement as indicated by this Ruby hash: NUCLEOTIDE_COMPLEMENT = { 'A' => 'T', 'T' => 'A', 'C' => 'G', 'G' => 'C' } The reverse-complement of a DNA string is a new string in which each nucleotide is replaced by its complement and the string is reversed. Reverse-complements are important in bioinformatics since a...

Give an example of a graph G with p(G) = 7 and c(G) = 3.

1. *Suppose that the economy is described by: Y =C(Y,T)+I(Y,i)+G, with G, T exogenous. (a) Use...

1. *Suppose that the economy is described by: Y =C(Y,T)+I(Y,i)+G, with G, T exogenous. (a) Use the total derivative to derive di/dY (b) What is the sign of this derivative? (c) What does the slope of the line depend on? Explain the intuition. (d) Graph this curve. (e) Use the total derivative to find dY/dG and dY/dT

. Find the Laplace transform of the functions: f(t) = 3e^5t t^3 − 6e^−t t^4 g(t)...

. Find the Laplace transform of the functions: f(t) = 3e^5t t^3 − 6e^−t t^4 g(t) = 5e^3t cos(4t) − 6e^2t sin(7t)

Subjects