1. Compute for the A + C : T + G ratios of the given DNA...

1. Compute for the A + C : T + G ratios of the given DNA strand in "A"

5' A A C C T A C T C C T G C G T G G G T G T C T T 3'

3' T T G G A T G A G G A C G C A C C C A C A G A A 5'

2. What happens if any of the protein for initiation of replication was not synthesized by the cell? Explain briefly why

Expert Solution

1 No of Adenine = 3

No of cytosine = 7

A+C= 10

No of guanine=6

no pf thymine= 8

T+G= 14

so A+C/T+G = 10/14= 0.714

2. The DNA replication is coupled with the cell cycle for the cell to function properly. So if there is a hault or incomplete DNA replication the cell will undergo death i.e apoptosis. The replication is regulated via proteins that are required for the initiation to form the origin of replication and the cyclin dependent kinases move cell cycle from G1-S-G2 phase. The oriC is activated with the help of protein complex in the G1 phase (pre-replicative complex) which contains the origin of recognition complex and other protein Cdc6, these are required for the initiation of the replication process.With the cell unable to produce these proteins, the origin of replication is deactivated which results in the inability to form replication fork. So the DNA cannot replicate and the chromosomes do not double in number which means after mitosis when the daughter split up each would get only half the chromosomes. This uncoupling of DNA replication from the cell cycle contribute to cell death by induction of DNA damage.

gladiator answered 2 years ago

A DNA string is a sequence of the bases a, c, g, and t in any...

A DNA string is a sequence of the bases a, c, g, and t in any order, whose length is usually a multiple of three. In reality, it is not necessarily a multiple of three, but we will simplify it as such for discussion. For example, aacgtttgtaaccagaactgt is a DNA string with a length of 21 bases. Recall that a sequence of three consecutive letters is called a codon. Assuming the first codon starts at position 1, the codons are...

A DNA strand is represented by a string of the characters A, C, G, and T,...

A DNA strand is represented by a string of the characters A, C, G, and T, each of which represents a nucleotide. Each nucleotide has its complement as indicated by this Ruby hash: NUCLEOTIDE_COMPLEMENT = { 'A' => 'T', 'T' => 'A', 'C' => 'G', 'G' => 'C' } The reverse-complement of a DNA string is a new string in which each nucleotide is replaced by its complement and the string is reversed. Reverse-complements are important in bioinformatics since a...

We would like to align two DNA sequences: (v) C G A T A C T,...

We would like to align two DNA sequences: (v) C G A T A C T, and (w) G A T T C G T : i) s(i, j) = 1.5 if vi = wj (matches); ii) s(i, j) = -1.0 if vi != wj (mismatches); iii) d = 0.25 (indels: insertions or deletions). What would be the maximum alignment score? Explain how you get the result.

3` - T A T A G A G C A A T T G C...

3` - T A T A G A G C A A T T G C T A C G T G T A T C C C G A G A C T C C G T A A – 5` 5` - A T A T C T C G T T A A C G A T G C A C A T A G G G C T C T G A G G C A...

Given the following economy: Y = C(Y - T) + I(r) + G C(Y - T)...

Given the following economy: Y = C(Y - T) + I(r) + G C(Y - T) = a + b(Y - T) I(r) = c - dr M/P = L(r,Y) L(r,Y) = eY - fr i. Solve for Y as a function of r, the exogenous variables G and T, and the model's parameters a, b, c, and d. ii. Solve for r as a function of Y, M, P, and the parameters e and f. iii. Derive the aggregate...

Describe DNA denaturation, renaturation (annealing) and how base composition (A & T v. C & G)...

Describe DNA denaturation, renaturation (annealing) and how base composition (A & T v. C & G) affects DNA stability

Given the following information G = 300 T = 200 C = 220...

Given the following information G = 300 T = 200 C = 220 + .6 (Y-T) I = 100 – 4r Md = .75Y – 6r Ms = 735 a. Derive the IS and LM curves. Calculate the equilibrium values of Y and r. b. Suppose that G is reduced until the budget deficit is eliminated. Calculate the new equilibrium values of Y and r. Explain the intuition of what happened, providing an IS/LM...

The curve C is given by the parameterization ⃗r(t) = <−t , 1 − t^2> for...

The curve C is given by the parameterization ⃗r(t) = <−t , 1 − t^2> for −1 ≤ t ≤ 1. a) Choose any vector field F⃗ (x, y) = 〈some function , some other function〉 and setup the work integral of F⃗ over C. b)Choose any vector field G⃗(x,y) which has a potential function of the form φ(x,y)= x^3 + y^3 + some other stuff and compute the work done by G⃗ over C. Please use a somewhat basic...

(1 point) For the given position vectors r(t)r(t) compute the unit tangent vector T(t)T(t) for the...

(1 point) For the given position vectors r(t)r(t) compute the unit tangent vector T(t)T(t) for the given value of tt . A) Let r(t)=〈cos5t,sin5t〉 Then T(π4)〈 B) Let r(t)=〈t^2,t^3〉 Then T(4)=〈 C) Let r(t)=e^(5t)i+e^(−4t)j+tk Then T(−5)=

Given the BS and IS for Simmons Mfg. Co., compute the ratios on the next page....

Given the BS and IS for Simmons Mfg. Co., compute the ratios on the next page. For each ratio indicate if Simmons is doing better or worse than the industry average by providing an “x” in the appropriate box. SHOW CALCULATIONS ON NEXT PAGE BELOW THE CHART. 20 points SIMMONS MANUFACTURING COMPANY Balance Sheet Assets Liabilities and Stockholders’ Equity Cash $ 15,000 Accounts Payable $ 21,000 Accts. Receivable 22,000 Notes Payable 20,000 Inventory ...

Question