Question
In: Biology
We would like to align two DNA sequences: (v) C G A T A C T,...
We would like to align two DNA sequences: (v) C G A T A C T, and (w) G A T T C G T :
i) s(i, j) = 1.5 if vi = wj (matches);
ii) s(i, j) = -1.0 if vi != wj (mismatches);
iii) d = 0.25 (indels: insertions or deletions).
What would be the maximum alignment score? Explain how you get the result.
Solutions
gladiator answered 7 months agoRelated Solutions
Describe DNA denaturation, renaturation (annealing) and how base composition (A & T v. C & G)...
Describe DNA denaturation, renaturation (annealing) and how base
composition (A & T v. C & G) affects DNA stability
For simplicity, you can consider DNA sequences as strings in the alphabet of {A, C, G,...
For simplicity, you can consider DNA sequences as strings in the
alphabet of {A, C, G, T}. Implement a special hash table to store
all short DNA segments of certain length (e.g., 20) found in a long
DNA sequence. Every DNA segment is stored as a (key, value) pair,
where the key is the sequence of the segment, and the value is the
position of the segment in the DNA. For example given a DNA
sequence of ACGTACGTTT, there are...
1. Compute for the A + C : T + G ratios of the given DNA...
1. Compute for the A + C : T + G ratios of the given DNA
strand in "A"
5' A A C C T A C T C C T G C G T G G G T G T C T T 3'
3' T T G G A T G A G G A C G C A C C C A C A G A A 5'
2. What happens if any of the protein for...
A DNA string is a sequence of the bases a, c, g, and t in any...
A DNA string is a sequence of the bases a, c, g, and t in any
order, whose length is usually a multiple of three. In reality, it
is not necessarily a multiple of three, but we will simplify it as
such for discussion.
For example,
aacgtttgtaaccagaactgt
is a DNA string with a length of 21 bases. Recall that a sequence
of three consecutive letters is called a codon. Assuming the first
codon starts at position 1, the codons are...
A DNA strand is represented by a string of the characters A, C, G, and T,...
A DNA strand is represented by a string of the characters A, C,
G, and T, each of which represents a nucleotide. Each nucleotide
has its complement as indicated by this Ruby hash:
NUCLEOTIDE_COMPLEMENT = {
'A' => 'T', 'T' => 'A', 'C' => 'G', 'G' => 'C'
}
The reverse-complement of a DNA string is a new string in which
each nucleotide is replaced by its complement and the string is
reversed. Reverse-complements are important in bioinformatics since
a...
3` - T A T A G A G C A A T T G C...
3` - T A T A G A G C A A T T G C T A C G T G T
A T C C C G A G A C T C C G T A A – 5`
5` - A T A T C T C G T T A A C G A T G C A C A T A G G G C T C T
G A G G C A...
V & T Faces, Inc., would like to open a retail store in Miami. The initial...
V & T Faces, Inc., would like to open a retail store in
Miami. The initial investment to purchase the building is $420,000,
and an additional $50,000 in working capital is required. Since
this store will be operating for many years, the working capital
will not be returned in the near future.
V & T Faces expects to remodel the store at the end of 3
years at a cost of $100,000. Annual net cash receipts from daily
operations (cash...
V & T Faces, Inc., would like to open a retail store in Miami. The initial...
V & T Faces, Inc., would like to open a retail store in
Miami. The initial investment to purchase the building is $420,000,
and an additional $50,000 in working capital is required. Since
this store will be operating for many years, the working capital
will not be returned in the near future. V & T Faces expects to
remodel the store at the end of 3 years at a cost of $100,000.
Annual net cash receipts from daily operations (cash...
V & T Faces, Inc., would like to open a retail store in Miami. The initial...
V & T Faces, Inc., would like to open a retail store in
Miami. The initial investment to purchase the building is $420,000,
and an additional $50,000 in working capital is required. Since
this store will be operating for many years, the working capital
will not be returned in the near future.
V & T Faces expects to remodel the store at the end of 3
years at a cost of $100,000. Annual net cash receipts from daily
operations (cash...
4. Transcribe and translate each of the following sequences. a. T A C A A A...
4. Transcribe and translate each of the following sequences.
a. T A C A A A G A C G G G T C C
b. G C A G G G C G A T T T A C A
c. T A C G C G C A C G T T A G C
d. C C G T G C A G G T A G A T T
ADVERTISEMENT
ADVERTISEMENT
Latest Questions
- Use the bond term's below to answer the question Maturity 7 years Coupon Rate 4% Face...
- What experience have you had with Organization Development or with Change Management? Describe the organization, the...
- 1. Renfro Rentals has issued bonds that have a 12% coupon rate, payable semiannually. The bonds...
- Given an array of positive integers a, your task is to calculate the sum of every...
- Define “culture.” Software is defined by the Merriam-Webster Dictionary as "the programs that run on a...
- In humans, hypotrichosis (sparse body hair) is a rare autosomal recessive condition. Let h = hypotrichosis...
- Increase all of the listing prices by 5% for all listings under $500,000 and 10% for...
ADVERTISEMENT