Question

In: Biology

We would like to align two DNA sequences: (v) C G A T A C T,...

We would like to align two DNA sequences: (v) C G A T A C T, and (w) G A T T C G T :

i) s(i, j) = 1.5 if vi = wj (matches);

ii) s(i, j) = -1.0 if vi != wj (mismatches);

iii) d = 0.25 (indels: insertions or deletions).

What would be the maximum alignment score? Explain how you get the result.

Solutions

Expert Solution

gladiator answered 1 month ago
Next > < Previous

Related Solutions

Describe DNA denaturation, renaturation (annealing) and how base composition (A & T v. C & G)...
Describe DNA denaturation, renaturation (annealing) and how base composition (A & T v. C & G) affects DNA stability
1. Compute for the A + C : T + G ratios of the given DNA...
1. Compute for the A + C : T + G ratios of the given DNA strand in "A" 5' A A C C T A C T C C T G C G T G G G T G T C T T 3' 3' T T G G A T G A G G A C G C A C C C A C A G A A 5' 2. What happens if any of the protein for...
A DNA string is a sequence of the bases a, c, g, and t in any...
A DNA string is a sequence of the bases a, c, g, and t in any order, whose length is usually a multiple of three. In reality, it is not necessarily a multiple of three, but we will simplify it as such for discussion. For example, aacgtttgtaaccagaactgt is a DNA string with a length of 21 bases. Recall that a sequence of three consecutive letters is called a codon. Assuming the first codon starts at position 1, the codons are...
A DNA strand is represented by a string of the characters A, C, G, and T,...
A DNA strand is represented by a string of the characters A, C, G, and T, each of which represents a nucleotide. Each nucleotide has its complement as indicated by this Ruby hash: NUCLEOTIDE_COMPLEMENT = { 'A' => 'T', 'T' => 'A', 'C' => 'G', 'G' => 'C' } The reverse-complement of a DNA string is a new string in which each nucleotide is replaced by its complement and the string is reversed. Reverse-complements are important in bioinformatics since a...
3` - T A T A G A G C A A T T G C...
3` - T A T A G A G C A A T T G C T A C G T G T A T C C C G A G A C T C C G T A A – 5` 5` - A T A T C T C G T T A A C G A T G C A C A T A G G G C T C T G A G G C A...
V & T Faces, Inc., would like to open a retail store in Miami. The initial...
V & T Faces, Inc., would like to open a retail store in Miami. The initial investment to purchase the building is $420,000, and an additional $50,000 in working capital is required. Since this store will be operating for many years, the working capital will not be returned in the near future. V & T Faces expects to remodel the store at the end of 3 years at a cost of $100,000. Annual net cash receipts from daily operations (cash...
V & T Faces, Inc., would like to open a retail store in Miami. The initial...
V & T Faces, Inc., would like to open a retail store in Miami. The initial investment to purchase the building is $420,000, and an additional $50,000 in working capital is required. Since this store will be operating for many years, the working capital will not be returned in the near future. V & T Faces expects to remodel the store at the end of 3 years at a cost of $100,000. Annual net cash receipts from daily operations (cash...
4. Transcribe and translate each of the following sequences. a. T A C A A A...
4. Transcribe and translate each of the following sequences. a. T A C A A A G A C G G G T C C b. G C A G G G C G A T T T A C A c. T A C G C G C A C G T T A G C d. C C G T G C A G G T A G A T T
You are given 2 sorted sequences of log(n) and n-1 keys. We would like to merge...
You are given 2 sorted sequences of log(n) and n-1 keys. We would like to merge those 2 sorted sequences by performing o(n) comparisons.[Note that we are interested in the comparisons and not the running time.] Show how this can be done or argue how this cannot be done. In class we show that ordinary merging would require no more than lg(n)+n-1+1 = n+lg(n) comparisons.
What is the mRNA sequence of the following original DNA sequences? a) TAC b) GAG c)...
What is the mRNA sequence of the following original DNA sequences? a) TAC b) GAG c) CAT d) AAA e) GCC f) TTC g) CCG h) TGT
ADVERTISEMENT
Subjects
ADVERTISEMENT
Latest Questions
ADVERTISEMENT