You place an order for 1 box of granola bars off of Amazon, the shipment comes...

You place an order for 1 box of granola bars off of Amazon, the shipment comes and there are 10 boxes of the granola bars. What are your obligations to the items you recieved?

Expert Solution

The obligation here would be to inform the delivery person that I have ordered only for one box of granola bars and there must be a mistake when the product was shipped. I would ask the delivery person how I can return the 9 boxes to the company. If I have already paid online for 1 box of granola bars then I would ask the company to send a representative to come and collect the remaining 9 boxes. If I have to make the payment on delivery then I would inform Amazon what has happened by calling the customer care and then pay only for one box. It will not be ethical to keep all the 10 boxes of granola bars when I have paid or paying only for one box. I would have got someone else's order and that person would have received just one box of granola bars. So it is always right to return the product that does not belong to me. Amazon might appreciate my honesty and ask me to keep another box of it but I am obligated to inform them about the situation and return the extra 9 boxes.

keosha answered 8 months ago

Jill comes to you and is interested in the mean calorie content of energy bars. She...

Jill comes to you and is interested in the mean calorie content of energy bars. She believes that the distribution of calorie content is approximately normal. You tell her to take a sample of energy bars. Jill comes back to you and says that she took a random sample of 12 energy bars, and found that, on average, there were 240 calories per bar, with a standard deviation of 30 calories. Use a 97% confidence interval?

1) You sent off a sample for sequencing in order to aid in prescribing the proper...

1) You sent off a sample for sequencing in order to aid in prescribing the proper treatment and got the following sequence back: a. TGGATTATGCGATGTCGGTCATTTTGGACCGGGCTTTGCGCATATCGCAGACGGTTTAAAGCCCGTCCAGCGTCGAATCGTGTACGCCATGTCAGAATTGGGTTTAAAATCAACCGCTAAGTATAAGAAATCAGCGCGGACGGTAGGCGACGTTTTGGGTAAATTCCATCCGCACGGAGACACCGCCTGTTACGAGGCCATGGTATTGATGGCCCAACCTTTTTCATTTCGCTATCCCTTTGTCGATGGGCAAGGCAATTGGGGGAGCGCGGATGATCCC AAATCCTTTGCCGCCATGCGTTATACGGAAGCACGTCTG b. Describe the complete process, step by step, that this protein plays a role in. 2)Use an online tool to transcribe and translate the sequence and paste below. Describe how that would be done inside the cell of the pathogen in detail. 3)E.coli has a glutamine at position 87 in this protein. Our pathogen...

1) A wheel with a weight of 396 N comes off a moving truck and rolls...

1) A wheel with a weight of 396 N comes off a moving truck and rolls without slipping along a highway. At the bottom of a hill it is rotating at an angular velocity of 27.5 rad/s . The radius of the wheel is 0.584 m and its moment of inertia about its rotation axis is 0.800 MR2. Friction does work on the wheel as it rolls up the hill to a stop, at a height of h above the...

I have accidentally send the incorrect order shipment, can you write an apology letter as a...

I have accidentally send the incorrect order shipment, can you write an apology letter as a template?

1. Uncle Iroh’s just made a mass M of tea, but it comes off the kettle...

1. Uncle Iroh’s just made a mass M of tea, but it comes off the kettle too hot at a temperature Thot. Zuko’s asleep, but will scold his uncle if he sees him drinking, so Iroh wants to cool the tea to Tdrink< Thot as quickly as possible. He has a bunch of ice cubes with side length 2l at temperature Tice<273 K< Tdrink. The mass-specific heat of the ice is cm ice; the water and tea both have mass-specific...

1. Uncle Iroh’s just made a mass M of tea, but it comes off the kettle...

1. Uncle Iroh’s just made a mass M of tea, but it comes off the kettle too hot at a temperature Thot. Zuko’s asleep, but will scold his uncle if he sees him drinking, so Iroh wants to cool the tea to Tdrink< Thot as quickly as possible. He has a bunch of ice cubes with side length 2l at temperature Tice<273 K< Tdrink. (assume tea off of kettle is all liquid.) The mass-specific heat of the ice is cm...

You place an order for 250 units of inventory at a unit price of $130. The...

You place an order for 250 units of inventory at a unit price of $130. The supplier offers terms of 1/10, net 30. a-1 How long do you have to pay before the account is overdue? a-2 If you take the full period, how much should you remit? b-1 What is the discount being offered? Discount offered? b-2 How quickly must you pay to get the discount? b-3 If you do take the discount, how much should you remit? c-1...

Order the events for the detection of somatic sensation. Place a 1 by the first event,...

Order the events for the detection of somatic sensation. Place a 1 by the first event, a 2 by the second and so on. The central process transmits the action potential to a second-order sensory neuron in the CNS. The action potential is transferred to the central process in the posterior root ganglion. The stimulus triggers an action potential. The signal is transferred to other (third order) CNS sensory neurons for eventual perception and interpretation. The action potential is propagated...

8. You place an order of 350 units of inventory at a unit price of $180....

8. You place an order of 350 units of inventory at a unit price of $180. The supplier offers terms of 2/10 Net 30. (10 Points) How long do you have to pay before the account is overdue? If you take the full period, how much should you remit? What is the discount being offered? How quickly must you pay to get the discount? If you take the discount, how much should you remit? If you don’t take the discount,...

Place the following patients in order for which you would see first as they come in...

Place the following patients in order for which you would see first as they come in through the emergency department. Explain why you would see them in this order. A. A patient with myasthenia gravis experiencing eye droop B. A 65 year old man with a blood pressure of 140/80 C. A 30 year old type II diabetic with a BS of 250

Question

You place an order for 1 box of granola bars off of Amazon, the shipment comes...

Solutions

Expert Solution

Related Solutions

Jill comes to you and is interested in the mean calorie content of energy bars. She...

1) You sent off a sample for sequencing in order to aid in prescribing the proper...

1) A wheel with a weight of 396 N comes off a moving truck and rolls...

I have accidentally send the incorrect order shipment, can you write an apology letter as a...

1. Uncle Iroh’s just made a mass M of tea, but it comes off the kettle...

1. Uncle Iroh’s just made a mass M of tea, but it comes off the kettle...

You place an order for 250 units of inventory at a unit price of $130. The...

Order the events for the detection of somatic sensation. Place a 1 by the first event,...

8. You place an order of 350 units of inventory at a unit price of $180....

Place the following patients in order for which you would see first as they come in...