Turkey (protein) has many essential amino acids such as tryptophan, threonine, isoleucine, lysine and phenylalanine. Threonine...

Turkey (protein) has many essential amino acids such as tryptophan, threonine, isoleucine, lysine and phenylalanine.

Threonine is a large amino acid and will broken be down into two products: pyruvate and succinyl CoA which are then fed into the citric acid cycle and electron transport chain.

Phenylalalanine is broken down into acetyl CoA and fumarate and fed into the citric acid cycle and electron transport chain.

Mayonnaise (fatty acid) has omega 3 alpha linolenic acid (18:3Δ9,12,15) and omega 6 linoleic acid (18:2Δ9.12). (omega 6 or omega 3 refer to where the double bonds are located when counting from the omega end)

Lastly the bread contains carbohydrates: Glucose. Let's be healthy and assume wheat bread. (Assume aerobic respiration and assume glycerol phosphate shuttle).

For each component of the turkey sandwich follow it through catabolism. Do the calculations to determine how much energy is produced from each component listed. I want energy producing steps written out.

Solutions

Expert Solution

gladiator answered 1 year ago

Next > < Previous

Related Solutions

A heptapeptide is shown to have the amino acid composition: phenylalanine glutamate methionine valine lysine threonine...

A heptapeptide is shown to have the amino acid composition: phenylalanine glutamate methionine valine lysine threonine and histidine. I treatment of the heptapeptide with cyanogen bromide yields a tetra and a tri-peptide II treatment of the tetrapeptide with dansyl chloride yields the dansyl derivative of histidine upon acid hydrolysis III treatment of the tetrapeptide with trypsin yields 2 dipeptides IV treatment of the tripeptide with carboxy peptidase yields primarily valine V a single round of Edman degradation of the tripeptide...

List the essential amino acids, and conditional essential amino acids. Determine when and where they are...

List the essential amino acids, and conditional essential amino acids. Determine when and where they are considered conditional essential amino acids.

Explain the importance of essential amino acids to animals

How many different primary structures could be formed using the four amino acids alanine, phenylalanine, serine...

How many different primary structures could be formed using the four amino acids alanine, phenylalanine, serine and valine? Write the amino acid sequences (using the three letter code) of all the possible peptides that begin with phenylalanine. You must use each amino acid once and only once in each peptide.

What is an amino acid? How many amino acids are there?

A mutation replaces the original amino acid, leucine, with threonine in a large protein. The altered...

A mutation replaces the original amino acid, leucine, with threonine in a large protein. The altered protein still functions, but less efficiently. What amino acid might replace leucine but with less effect on protein functions? What amino acid might replace leucine but with even a worse effect on the how the protein functions? a) less effect if lysine; worse if alanine b) less effect if methionine; worse if lysine c) less effect if methionine; worse if alanine d) less effect...

A large protein of 1205 amino acids was produced errors of average 8 mistakes/200 amino acids....

A large protein of 1205 amino acids was produced errors of average 8 mistakes/200 amino acids. Calculate probability to produce protein with: No mutation Less than 2 mutations Exactly 3 mutations Give mathematical expression and the number used in these expressions.

describe the sources non essential amino acids in human organism.( for each non essential amino acid...please...

describe the sources non essential amino acids in human organism.( for each non essential amino acid...please more explanation)

1) How many amino acids long is the protein with the following sequence? 5’ tctaaaatgtcagatgtaaagtgcacatcagtagtcttactctcagttttgtaacaactc 3’...

1) How many amino acids long is the protein with the following sequence? 5’ tctaaaatgtcagatgtaaagtgcacatcagtagtcttactctcagttttgtaacaactc 3’ 3’ agattttacagtctacatttcacgtgtagtcatcagaatgagagtcaaaacattgttgag 5’ 2) Design a set of 6 base pair long primers that scientists could use to amplify the entire sequence of the gene in Q1 3) T/F. A base pair substitution (ie. a point mutation) that introduces a nonsense mutation could be introduced to the sequence encoding the protein in Q1.

The amino acid glutamic acid has the molecular formula C5H9NO4, and the amino acid isoleucine has...

The amino acid glutamic acid has the molecular formula C5H9NO4, and the amino acid isoleucine has the molecular formula C6H13NO2. Determine how many moles of isoleucine contain the same number of atoms as 1.96 mol of glutamic acid.

Subjects