1. Find the 100th and the nth term for each of the following sequences. a. 50,90,130,......

1. Find the 100th and the nth term for each of the following sequences.

a. 50,90,130,...

b. 1,4,16,...

c. 7, 7⁴,7⁷,7¹⁰,...

d. 197+7x3²⁷, 197+8x3²⁷, 197+9x3²⁷,...

2. Find the first five terms in sequences with the following nth terms.

a. 10ⁿ-5

b.2n-1

3. How many terms are there in each of the following sequences?

a. 11,15,19,23,...331

b. 59,60,61,62,...459

Expert Solution

Colby Messinger answered 2 years ago

1.) Find the 100th and the nth term for each of the following sequences. a. 1,3,5,7,......

1.) Find the 100th and the nth term for each of the following sequences. a. 1,3,5,7,... b.70,100,130... c.1,3,9... d.8,84,87,810,... e. 200+6x231, 200+7x231, 200+8x231 2. Find the first five terms in sequences with the following nth terms. a. 2n2+6 b.4n+1 c. 10n-5 d.2n-1

Use the formula for the general term (the nth term) of an arithmetic sequence to find...

Use the formula for the general term (the nth term) of an arithmetic sequence to find the sixth term of the sequence with the given first term and common difference. a1 =15; d=7 a6 =

For each sequence given below, find a closed formula for an, the nth term of the sequence (assume...

For each sequence given below, find a closed formula for an, the nth term of the sequence (assume the first terms here are always a0) by relating it to another sequence for which you already know the formula. −1,0,7,26,63,124,… an=(n^3)-1 −1,1,7,17,31,49,… an=2n^2-1 0,10,30,60,100,150,..... an=10*((n(n+1))/2) 2,3,6,14,40,152,… an= The first three are correct I can't figure out the last one.

Given the following series: 1, 2, 5, 26, 677, ….. such that the nth term of...

Given the following series: 1, 2, 5, 26, 677, ….. such that the nth term of the series equals to (n-1)th ^2 +1 and the first term of the series is 1. Write a C program using recursive function named f to compute the nth term. Use for loop to print the values of first n terms in the series. You will take input n from the user. Example output: Enter number of terms: *value* *numbers here* nth term: *value*...

For each of the following sequences find a functionansuch that the sequence is a1, a2, a3,...

For each of the following sequences find a functionansuch that the sequence is a1, a2, a3, . . .. You're looking for a closed form - in particular, your answer may NOT be a recurrence (it may not involveany otherai). Also, while in general it is acceptable to use a "by cases"/piecewise definition, for this task you must instead present a SINGLE function that works for all cases.(Hint: you may find it helpful to first look at the sequence of...

Find a closed formula for each of the following sequences. Show all work and explain your...

Find a closed formula for each of the following sequences. Show all work and explain your answers. (a) {1, 6, 17, 34, 57, 86, 121, . . .}, where a0 = 1. (b) an = 5an−1 + 4, a0 = 2 (c) an = 10an−1 − 21an−2, a0 = 6, a1 = 26.

find a patternin the following sequences and write the next two terms. classify each seqences as...

find a patternin the following sequences and write the next two terms. classify each seqences as arithmetic geometic or neither 1,4,16,64, and 3,6,9,12

6. The following sequences are mutations of the template sequence in question 1. For each mutated...

6. The following sequences are mutations of the template sequence in question 1. For each mutated sequence, indicate the new amino acid sequence produced and the type of mutation that is the end result in the amino acid (frameshift, Missense, nonsense, silent) as well as the type of mutation that occurred in the DNA sequence (substitution, addition, deletion) Template sequence question 1: 3’ TACCCTGGTGGTTTGCGGACT 5’ a. 3’ TAC CCG GTG GTT TGC GGACT 5’ b. 3’ TAC ACT GGTGGTTTGCGGACT 5’...

If the pth term of an AP is q and the qth term is p, prove that its nth term is (p + q - n).

I have the following question: Write a recursive function to find the Nth element from the...

I have the following question: Write a recursive function to find the Nth element from the top of a stack. For example, if N is 3 the function should return the third element in the stack. Use the following header: template <class Type> Type getNth( stack<Type> & s, int n) Although your function may push and pop values from the stack, it must eventually leave the stack in its original state. Your function may NOT use a help stack or...

Question