C. BRCA1 has been shown to be upregulated by p53 upon DNA damage. If you gave...

C. BRCA1 has been shown to be upregulated by p53 upon DNA damage. If you gave the p53 homozygous mutant mice you made in B a drug that increases DNA damage would you expect an increase or decrease in BRCA1 protein in mammary tissue where it is normally expressed, compared to wild type mice given the same drug (yes or no)? Why or why not?

Expert Solution

hope you'll get the problem now. Please mention in comment if you have any other query regarding the problem. I'll help you out

gladiator answered 2 years ago

What role does p53 play in mediating cell cycle arrest for cells with DNA damage? How...

What role does p53 play in mediating cell cycle arrest for cells with DNA damage? How is p53 activated?

What kind of damage UV light is causing in DNA? What effect this damage has on...

What kind of damage UV light is causing in DNA? What effect this damage has on the cell growth?

You are caring for a child with an arm fracture that has recently been casted. Upon...

You are caring for a child with an arm fracture that has recently been casted. Upon routine assessment you notice that his fingers are swollen, capillary refill is sluggish, and he is stating that his arm feels "funny". What should your first action be?

An experiment has been initiated in a laboratory where recombinant DNA technology has been used to...

An experiment has been initiated in a laboratory where recombinant DNA technology has been used to substitute the gene responsible for change of colour in chameleon with another gene responsible for “glowin-the-dark”. If this experiment is successful, chameleons carrying the “glow-in-the-dark” gene will not be able to change their colours any longer. Discuss the implication of these results in terms of ethics and conservation biology.

11. If the offer has been revoked, it has no longer valid and has no binding force upon the offerer.

T or F11. If the offer has been revoked, it has no longer valid and has no binding force upon the offerer.12. In Liner transportation, the freight is inclusive of loading and unloading costs.13. According to Incoterms 2020, under FCA, if the place of delivery is at seller’s premises, the seller fulfills his delivery obligation when the goods are loaded on the means of transport provided by the buyer.

Environmental damage and loss of human life has only been applying compensation. Should corporate executives face...

Environmental damage and loss of human life has only been applying compensation. Should corporate executives face criminal punishment, i.e. prison sentences?

Part C As a healthcare manager, you may be called upon to develop a compliance plan...

Part C As a healthcare manager, you may be called upon to develop a compliance plan for your healthcare organization. The office of inspector general suggests seven guiding principles/elements to be included in any compliance plan. These elements are presented in chapter 2 and reproduced below. Designation of a compliance officer and a compliance committee Development of compliance policies and procedures, including standard of conduct Developing open lines of communication Appropriate and education Internal monitoring and auditing Response to detected...

Short Answer 3 It has been shown that one of the symptoms of coronavirus is a...

Short Answer 3 It has been shown that one of the symptoms of coronavirus is a loss of smell. What are some of the hypotheses for how this loss of smell might be caused? For any of the hypotheses, what are three experiments you would carry out to investigate that hypothesis.

For simplicity, you can consider DNA sequences as strings in the alphabet of {A, C, G,...

For simplicity, you can consider DNA sequences as strings in the alphabet of {A, C, G, T}. Implement a special hash table to store all short DNA segments of certain length (e.g., 20) found in a long DNA sequence. Every DNA segment is stored as a (key, value) pair, where the key is the sequence of the segment, and the value is the position of the segment in the DNA. For example given a DNA sequence of ACGTACGTTT, there are...

You are given a piece of eukaryotic DNA which is shown below /6 marks 5’- CACTCACCCGATTTTTGAATGGCCCTGATGAATCTCTGGTAA -3’...

You are given a piece of eukaryotic DNA which is shown below /6 marks 5’- CACTCACCCGATTTTTGAATGGCCCTGATGAATCTCTGGTAA -3’ a) If this is the coding strand, what is the mRNA produced (label both the 3’ and 5’ ends)? b) If this is the template strand, what is the mRNA produced (label both the 3’ and 5’ ends)? c) Assuming that the DNA sequence above is the coding strand, predict the amino-acid sequence of the protein produced from the piece of mRNA using single letter codes. In...

Question