Question

In: Biology

You are given a piece of eukaryotic DNA which is shown below /6 marks 5’- CACTCACCCGATTTTTGAATGGCCCTGATGAATCTCTGGTAA -3’...

You are given a piece of eukaryotic DNA which is shown below /6 marks

^5’- CACTCACCCGATTTTTGAATGGCCCTGATGAATCTCTGGTAA -^3’

a) If this is the coding strand, what is the mRNA produced (label both the 3’ and 5’ ends)?

b) If this is the template strand, what is the mRNA produced (label both the 3’ and 5’ ends)?

c) Assuming that the DNA sequence above is the coding strand, predict the amino-acid sequence of the protein produced from the piece of mRNA using single letter codes. In your answer denote both the amino and carboxy ends of the protein.

Expert Solution

Answer =

You are given a piece of eukaryotic DNA which is shown below /6 marks

5’- CACTCACCCGATTTTTGAATGGCCCTGATGAATCTCTGGTAA -3’

a) If this is the coding strand, what is the mRNA produced (label both the 3’ and 5’ ends)?

5’- CACTCACCCGATTTTTGAATGGCCCTGATGAATCTCTGGTAA -3’ ----------- DNA coding sequence

3' -GTGAGTGGGCTAAAAACTTACCGGGACTACTTAGAGACCATT - 5'---------- DNA template

Transcription

5' - CACUCACCCGAUUUUUGAAUGGCCCUGAUGAAUCUCUGGUAA-3'------------mRNA sequence.

=====================================================================================

b) If this is the template strand, what is the mRNA produced (label both the 3’ and 5’ ends)?

5’- CACTCACCCGATTTTTGAATGGCCCTGATGAATCTCTGGTAA -3’------template strand.

transcription

3' -GUGAGUGGGCUAAAAACUUACCGGGACUACUUAGAGACCAUU-5' mRNA strand.

=======================================================================================

c) Assuming that the DNA sequence above is the coding strand, predict the amino-acid sequence of the protein produced from the piece of mRNA using single letter codes. In your answer denote both the amino and carboxy

5’- CACTCACCCGATTTTTGAATGGCCCTGATGAATCTCTGGTAA -3’ ----------- DNA coding sequence

3' -GTGAGTGGGCTAAAAACTTACCGGGACTACTTAGAGACCATT - 5'---------- DNA template

Transcription

5' - CAC UCA CCC GAU UUU UGA AUG GCC CUG AUG AAU CUC UGG UAA-3'------------mRNA sequence.

N -teminal -His- Ser- Pro- Asp-phe- C terminal

N-terminal - H - S- P- D- F- C terminal ------------amino acid sequence of protein.

gladiator answered 2 years ago

The following is a strand of eukaryotic cDNA DNA: 5'- catgtctdacagctggccgcca- 3' a) convert the dna...

The following is a strand of eukaryotic cDNA DNA: 5'- catgtctdacagctggccgcca- 3' a) convert the dna above to its complementary DNA strand (must labe the 5' or 3' ends) b) dna is converted to mrna is process is called____? c) convert this dna (5'- catgtctdacagctggccgcca- 3') to its mrna message d) provide the protein sequence for this dna (5'- catgtctdacagctggccgcca- 3'_ remember this is done in a standard eukaryotic cell.

Examine the DNA sequence shown below. How many possible reading frames does this piece of DNA...

Examine the DNA sequence shown below. How many possible reading frames does this piece of DNA have? Explain where they are. Which one can be used and how do you know? 5'-AGTCGA TCGAACGGTCA TCG-3' 3'-TCAGCTAGCTTGCCAGTAGC-5' What feature of eukaryotes makes annotation more difficult? Describe the process whereby DNA is transferred from Agrobacterium to plants.

Given the matrix as shown below n_array = 3 1 8 3 5 7 4 9...

Given the matrix as shown below n_array = 3 1 8 3 5 7 4 9 2 Write a M-file script program that generates this n_array, and answer each question using one line of MATLAB statement. a) Replace the second column of the n_array with a column of 0s b) Replace the element in the second-row, third-column with a zero c) Change the n_array to a 4 x 3 array by adding a row of 0s The end result for...

Given the sequence 5’-AGTTACCTGA-3’ what would be the sequence of the complementary DNA strand? Which of...

Given the sequence 5’-AGTTACCTGA-3’ what would be the sequence of the complementary DNA strand? Which of the following? 5’-TCAATGGACT-3’ 3’-AGTTACCTGA-5' ’5’-AGTTACCTGA-3’ 3’-TCAGGTAACT-5’ 5’-TCAGGTAACT-3’

Which is the mRNA complement of the DNA sequence 5’ ACGGTCGGAT 3’ 5’ ACGGTCGGAT 3’ 5’...

Which is the mRNA complement of the DNA sequence 5’ ACGGTCGGAT 3’ 5’ ACGGTCGGAT 3’ 5’ AUCCGACCGU 3’ 5’ TGCCAGCCTA 3’ 5’ UGCCAGCCUA 3’ Answer question a in the first row (with a number). For statements b-k, enter an X to indicate if it is associated with DNA replication, transcription or translation. A statement may apply to more than one. DNA Replication Transcription Translation Number of template DNA strands? ________ ________ N/A Uses DNA polymerase Uses RNA polymerase Requires ribosomes...

The random sample shown below was selected from a normal distribution. 3, 6, 5, 9, 9,...

The random sample shown below was selected from a normal distribution. 3, 6, 5, 9, 9, 4 Complete parts a and b. a. Construct a 95% confidence interval for the population mean mu. b.Assume that the sample mean x and sample standard deviation s remain the same as those you just calculated but that are based on a sample of n=25 observations. Repeat part a. What is the effect of increasing the sample size on the width of the confidence...

The random sample shown below was selected from a normal distribution. 3, 5, 9, 4, 6,...

The random sample shown below was selected from a normal distribution. 3, 5, 9, 4, 6, 9 Complete parts a and b. A. Construct a 95% confidence interval for the population mean μ . (___,___) B. Assume that sample mean x and sample standard deviation s remain exactly the same as those you just calculated but that are based on a sample of n = 25 observations. Repeat part a. What is the effect of increasing the sample size on...

Write pseudocode (3 Marks) and program structure (4 Marks) for the problem given below; In a...

Write pseudocode and program structure (4 Marks) for the problem given below; In a college, students are awarded a pass grade if their total mark is between 50-59, credit grade if the mark is between 60-69, distinction for marks between 70-79. High distinction if the mark is above or equal to 80 and fail if the mark is below 50.

The diagram of a eukaryotic ribosome shown below contains several errors

The diagram of a eukaryotic ribosome shown below contains several errors Part A Examine the diagram carefully, and identify each error. Select all that apply. the number of ribosomal subunits is incorrect the ribosome is moving in the wrong direction along the MRNA the amino acid on the tRNA in the A site is incorrect the terminal amino acid of the peptide is incorrect the MRNA incorrectly contains Ts the MRNA incorrectly contains adenines small ribosomal subunit size is incorrect the amino acids on the tRNA in the P site...

The following DNA sequence occurs at the start of a DNA strand: 3′—AATTGCAGATTCA—5′. Which of the...

The following DNA sequence occurs at the start of a DNA strand: 3′—AATTGCAGATTCA—5′. Which of the sequences below would most likely bind to this sequence to initiate DNA replication through the formation of RNA ? A. 5′—TTAACGTCTAAGT—3′ B. 3′—TTAACGTCTAAGT—5′ C. 3′—UUAACGUCUAAGU—5′ D. 5′—UUAACGUCUAAGU—3′