Question

Part II: Beeyoncé

There once was a young bee larvae by the name of Beeyoncé. She dreamed to become queen bee like her mother. Her mother as queen ate very well before giving birth to Beeyoncé which primed her to become the next queen.

1. In a few sentences, explain in your own words the importance of parental diet and nutrition in terms of epigenetics. (10 pts)

Beeyoncé told the current queen of her dream. The queen replied “Can you handle this? “I don’t think you are ready for this Royal Jelly that we have.” Beeyoncé stuck it out and ate her jelly like the true survivor she is and became Queen Beeyoncé effectively telling the current queen to put her stuff in a box to the left as she now runs the world.

2. In a few sentences, explain in your own words the epigenetics behind why there can only be one single lady (i.e. queen bee) for each bee hive. (10 pts)

Part III: Questionable Reception

Most of the above nutrients in the table do not bind or interact directly to DNA and require a receptor to facilitate interaction. Let’s assume the below gene codes for a receptor to bind to DADS.

3’ - GATTACAGATTACAGATTACA – 5’

You have a T to a C point mutation in the first T on the 3’ end of the below sequence. This is what makes you S.P.E.C.I.A.L.

1. Write the RNA sequence for the mutated version of the sequence. (5 pts)

2. Write the protein sequence for the mutated version of the sequence. (10 pts)

3. What kind of point mutation occurred when the T switched to a C? (5 pts)

4. Would your body be able to uptake and process DADS in your diet? (10 pts)

Answer 1

Q1 parental nutrition is of utmost importance where epigenetics is concerned. The right amount and quality of nutrition can help with reducing the damage of the offspring.. the good nutrients are involved in growth and development of the child. The chemical derivatives can aid in lesser mutations and lesser DNA damage.

In certain mice the colour of the coat and patterns can be helped with good quality nutrition.Royal jelly is rich food given to worker larvae, and is necessary for the larva to develop into a fertile queen bee. The larva is enclosed with a cell inside the hive and develops into a queen.

Q2.Queens are developed from larva selected by the worker bees and specially fed in order to become sexually mature.She is the only female with fully developed ovaries. The queen’s two primary purposes are to produce chemical scents that help regulate the unity of the colony and to lay lots of eggs. As a queen ages, her egg-laying capability slows down, which results in less brood each season. Less brood means a smaller colony

Q3 5'ACAUUAGACAUUAGACAUCAG 3' RNA sequence

Protein sequence has 7 codons threonine, leucine, aspartic acid, isoleucine, Argenine, histadine, glutamic acid.

The C to T point mutation is transition mutation.

Yes we can take up DADS the amino acids can be utilized by the human body as they are considered as esstional amino acids