Question

In: Biology

Design an oligonucleotide-based probe for purifying all the mature mRNA from eukaryotic cell lysates.

Design an oligonucleotide-based probe for purifying all the mature mRNA from eukaryotic cell lysates.

Solutions

Expert Solution

For Purifying all mature mRNA from eukaryotic cell lysate, we can be use the method called tandem RNA ISOLATION PROCEDURE (TRIP ). In this method streptavidin beads are tagged with 3' biotinylated 2' O methylated antisense RNA oligonucleotide.

Tandem RNA isolation procedure (TRIP) that enables the purification of endogenously formed mRNA-protein complexes from cellular extracts. The two-step protocol involves the isolation of Polyadenylated mRNAs with antisense Oligo(dT) beads and subsequent capture of an mRNA of interest with 3'-biotinylated 2'-O-methylated antisense RNA oligonucleotides, which can then be isolated with streptavidin beads.

ANTI SENSE OLIGONUCLEOTIDE

  1. Secondary analysis of mRNA analysis using one of online tool called as VIENNA RNA Website with suitable option such as MFE (minimum free energy ) partition function and avoid isolated base pair option. All eukaryotic cell mRNA have poly AA Tail at 3' end of mRNA thus oligonucleotide with poly T tail could be design over streptavidin bead which will capture all mRNA with poly A tail.
  2. For preferentially specific mRNA , the probe oligonucleotide should have 21-24 nucleotide long sequence which do not have secondary structure and binds with 3' untranslated region (3UTR) of mRNA. There should not be tandem repeats to avoid potential formation of hairpin or self annealing as well as must have 50% G/C ratio.
  3. Another way is manually design 2' Methoxy Modification RNA Nucleotide with biotin moiety at 3' and is fully complementary to target mRNA. 2' methoxy allow protection from cellular RNase present in cell lysate and duplex melting Temperature increases allow stringent washing leading to high purified mRNA.

Related Solutions

The difference between a pre-mRNA and a mature eukaryotic mRNA is __________. a. the 5' and...
The difference between a pre-mRNA and a mature eukaryotic mRNA is __________. a. the 5' and 3' ends have been modified in mRNA b. the removal of the leader sequence from the pre-mRNA c. the fact that all introns have been spliced out in the mRNA d. Both a and c Which of the following statement is TRUE about transcription? a. Transcription in prokaryotes does not differ from transcription in eukaryotes. b. Prokaryotes carry out transcription in the cytosol, whereas...
How are the eukaryotic primary mRNA transcripts processed before they can be transported from the cell...
How are the eukaryotic primary mRNA transcripts processed before they can be transported from the cell nucleus to the ribosomes in the cytosol?
how is a eukaryotic transcript different from finished mRNA? what about a prokaryotic primary transcript?
how is a eukaryotic transcript different from finished mRNA? what about a prokaryotic primary transcript?
1. Write the difference between a prokaryotic and a Eukaryotic cell based on the following criteria:...
1. Write the difference between a prokaryotic and a Eukaryotic cell based on the following criteria: Criteria    Prokaryotic cell Eukaryotic Cell Examples    ---------------------- ------------------- Nucleus -------------------- --------------------- DNA / Chromosome ----------- -------------------------    Membrane enclosed cell organelles -----------------    ------------------    Endomembrane system --------------- ------------------- 2.  Compare Gram positive and Gram negative bacterial cell wall based on the following Criteria: Criteria    Gram (+) Cell Wall Gram (-) Cell wall Peptidoglycan content ------------- ------------------- Teichoic acid    --------------------------- --------------------------...
1. Draw a detailed Eukaryotic cell 2. Label the cell and all its structures 3. Write...
1. Draw a detailed Eukaryotic cell 2. Label the cell and all its structures 3. Write a brief description explaining how 4 organelles (of your choosing) function and how their functions are interconnected.
Ribosomes can normally be found in all of the following eukaryotic cell locations except: A. the...
Ribosomes can normally be found in all of the following eukaryotic cell locations except: A. the outer nuclear membrane B. the rough endoplasmic reticulum C. the mitochondrion D. the inner nuclear membrane E. the chloroplast
10a. Name the three post-transcriptional processing events that take place to generate a mature mRNA from...
10a. Name the three post-transcriptional processing events that take place to generate a mature mRNA from a nascent transcript? 1. ________________________________________________________ 2. ________________________________________________________ 3. ________________________________________________________ b. Describe a specific example of how one of these processing events can provide functional diversity for a given gene.
Part of a gene sequence from a eukaryotic cell is written below. Transcription begins at the...
Part of a gene sequence from a eukaryotic cell is written below. Transcription begins at the boxed G/C base pair and proceeds from left to right. 5’-CCGATAAATGGCCGATTACGATATGCCAGATCATTACAACTAACGAGGCC -3’ 1 - - - - - - - - - - +- - - - - - - - - - -+- - - - - - - - - - +- - - - - - - - -+ - - - - - - - - - - - -+...
How is eukaryotic cell division different from prokaryotic? ( I know prokaryotic is simpler, but i...
How is eukaryotic cell division different from prokaryotic? ( I know prokaryotic is simpler, but i need a little more explanation)
If all 5' and 3' splice sites were always used to process the pre-mRNA into mRNA, how many possible distinct mRNA sequences would result from this processing?
If all 5' and 3' splice sites were always used to process the pre-mRNA into mRNA, how many possible distinct mRNA sequences would result from this processing?
ADVERTISEMENT
ADVERTISEMENT
ADVERTISEMENT