Question

In: Computer Science

Code in python the grocery receipt the following steps using the knowledge you have. declare a...

Code in python the grocery receipt the following steps using the knowledge you have. declare a string variable called card_number. Assign a value of “xxx8974” declare a string variable called date and assign a string value of “9\7\2020” You need to use an escape sequence for the slashes in this string. See Mosh’s video 2.4-Escape Sequence if needed. You do not need to use a date class variable as we have not learned that data type yet. Use a simple string variable. declare a float number variable called cookies_cost and assign value of 3.15 Save and test frequently to catch errors early declare a float number variable called chips_cost and assign value of 3.15 declare a float number variable called salsa cost and assign value of 5.10 declare a float number variable called total_cost and assign a value that adds cookies_cost plus ships_cost plus salsa_cost. Use multiple print() functions to print the following receipt as exampled in the following figure Consider using string interpolation to combine text and number variables on the same line. String interpolation example: print(f”Borrower does not qualify at {rate}”) How will you format 5.1 to display 5.10? Search Google for “python display two decimals” and read the articles. We want you to be able to learn from good online articles.

Solutions

Expert Solution

Answer:

here is the python code as per your requirements or instructions in the code

Raw code:

#card number

card_number="xxx8974"

#date using escape sequences

date="9\\7\\2020"

#assingning float values

cookies_cost=3.15

chips_cost=3.15

salsa_cost=5.10

#total cost by adding all the cost

total_cost=cookies_cost+chips_cost+salsa_cost

#let the rate be 5.1

rate=5.1

#string interpolation and printing the 5.1 as 5.10 using rate:.2f for decimal points

print(f"Borrower does not qualify at {rate:.2f}")

Editor:

output:

Hope this helps you! If you still have any doubts or queries please feel free to comment in the comment section.

"Please refer to the screenshot of the code to understand the indentation of the code".

Thank you! Do upvote.


Related Solutions

I have the following python code. I get the following message when running it using a...
I have the following python code. I get the following message when running it using a test script which I cannot send here: while textstring[iterator].isspace(): # loop until we get other than space character IndexError: string index out of range. Please find out why and correct the code. def createWords(textstrings): createdWords = [] # empty list for textstring in textstrings: # iterate through each string in trxtstrings iterator = 0 begin = iterator # new begin variable while (iterator <...
Please based on my python code. do the following steps: thank you Develop a method build_bst...
Please based on my python code. do the following steps: thank you Develop a method build_bst which takes a list of data (example: [6, 2, 4, 22, 34, 9, 6, 67, 42, 55, 70, 120, 99, 200]) and builds a binary search tree full of Node objects appropriately arranged. Test your build_bst with different sets of inputs similar to the example provided above. Show 3 different examples. Choose 1 example data.  Develop a function to remove a node from a bst...
USING YOUR KNOWLEDGE OF MODULES, REWRITE THE FOLLOWING BATCH OF CODE USING PSEUDOCODE AND CREATE A...
USING YOUR KNOWLEDGE OF MODULES, REWRITE THE FOLLOWING BATCH OF CODE USING PSEUDOCODE AND CREATE A FLOWCHART TO REPRESENT THE LOGIC: There’s one thing every coder must understand. The System.out.println command. There’s one thing every coder must understand. The System.out.println command.
How would you do the following using Python code: For the second exercise determine the union,...
How would you do the following using Python code: For the second exercise determine the union, intersection and difference of the square and cube of integers ranging from 1 to 100. Sets are clearly the way to go here. You can use Math functions to generate the sets for the square and cube for the Integers. The following functionality should be available for the user via a simple interface: 1. Display the Square and Cube for Integers ranging from 1...
How would you do the following using Python code: For the second exercise determine the union,...
How would you do the following using Python code: For the second exercise determine the union, intersection and difference of the square and cube of integers ranging from 1 to 100. Sets are clearly the way to go here. You can use Math functions to generate the sets for the square and cube for the Integers. The following functionality should be available for the user via a simple interface: 1. Display the Square and Cube for Integers ranging from 1...
Using Python code create a program only with beginners code. You are taking online reservations at...
Using Python code create a program only with beginners code. You are taking online reservations at the The inn Ask for your client’s name and save in a variable Ask how many nights your client will be staying and save in a variable Room rental is $145 per night Sales tax is 8.5% Habitation tax is $5 per night (not subject to sales tax) Print out: Client’s name Room rate per night Number of nights Room cost (room rate *...
Do the following code by using python: ( Thank!) You roll two six-sided dice, each with...
Do the following code by using python: ( Thank!) You roll two six-sided dice, each with faces containing one, two, three, four, five and six spots, respectively. When the dice come to rest, the sum of the spots on the two upward faces is calculated. • If the sum is 7 or 11 on the first roll, you win. • If the sum is 2, 3 or 12 on the first roll (called “Mygame”), you lose (i.e., the “house” wins)....
Using your knowledge of DNA replication, copy the following. Write down all the important steps and...
Using your knowledge of DNA replication, copy the following. Write down all the important steps and players of the reaction. Show the primer location and derive the complimentary strand sequence. 5` - AGATTCTGAGTCGTGACTCGTACGTCATAACTT -3`
implement a Message Authentication Code program in either C/C++ or Python. See the following steps. 1....
implement a Message Authentication Code program in either C/C++ or Python. See the following steps. 1. Accept a message as keyboard input to your program. 2. Accept a secret key for the sender/recipient as keyboard input to your program. 3. Your hash function H() is simply the checksum. To compute the checksum, you add all the characters of the string in ASCII codes. For example, the checksum of a string "TAMUC" would be 84 + 65 + 77 + 85...
For this problem, you should: describe the algorithm using aflowchart and thenwrite Python code...
For this problem, you should: describe the algorithm using a flowchart and thenwrite Python code to implement the algorithm.You must include:a.) a picture of the flowchart you are asked to create,b.) a shot of the Python screen of your code, andc.) a shot of the Python screen of your output.Program Requirements: Your application will implement a stopwatch to beused during a 1500-meter race in a swimming match. The input to theapplication will be the number of seconds for two different...
ADVERTISEMENT
ADVERTISEMENT
ADVERTISEMENT