The lab tested for certain expressed virulence factors from Chris ’s actual serum and found: >cDNA...

The lab tested for certain expressed virulence factors from Chris ’s actual serum and found:

>cDNA

TTGCTCTTACTTCCGGTTCGCAGCGTACAGTTAAGAAGAGCAAGCACGATACGCCGCCAAGGTGGCCTCA GTCGACTAGCAATGCAGCTCGTGCCGCGAGAGATCGATAAACTGACCATCTCTAATCTGGGATTTCTGGC CCAGCGGAGATTGGCCCGGGGAGTGAGGTTGAATCATGCAGAAGCGACTGCGTTGATCGCATCCAATCTC CAAGAGCTTATTCGAGATGGCAACAATTCGGTGGCAGATCTCATGACGATCGGCAAGGAGATGCTTGGAC GTCGACATGTCCTACCCTCTGTCGTGGCCACCTTGAAACAAGTTCAAGTTGAAGGAACTTTTCCCACTGG GACGAACCTGATCACCGTGGTCAATCCCGTTTGTTCGGATGATGGCGACCTGGAGAAAGCCCTCTACGGA AGCTTTTTGCCTGTGCCGCCGAAAGAAACGTTCCCGGATCCTGATCCGGATGACTATCAGCCAGAGAAGA TGCCTGGCGCTGTGATACCCCTCAAAACGAGCAAGAAAATTGAGCTCAATGCCGGGAGAAATAGAATTAT GCTTAAAGTGACAAGTCGAGGAGACCGGCCCATTCAGGTTGGTTCACACTATCATTTTATAGAGGTGAAT CCACAATTGGACTTCGACCGTGCGAAGGCGTACGGATATCGCCTTGACATCCCAGCTGGGACGTCTATCC GCTTTGAACCCGGTGCTACCAAGGCAATCCCGCTCGTCGAAATTGGCGGCAAGAGAATCATTCGAGGGGG CAACCACATCGCCGTTGGGCAGGTGGATTTCCGAAGAGTTGATGAAATCATCATGCGTCTGCAAAAAGCT GGATTTGCGTATACTCCGGAGCCTAAACAGGATGCTCATTTGATCGAGCCATTTTCAATGACGCGGGAAG CATATGCTCGCATGTTTGGTCCTACCACTGGAGATGTAGTCAAGCTAGGAACCACAGATTTGTGGATTAA AGTCGAAAAGGACCTGACCTACTACGGTGACGAATGTTCATTCGGTGGTGGCAAGACCATAAGAGACGGG ATGGGGCAAGCTACAGGAAGGCATTCCGTGGATGTCCTGGATACAGTCCTGGTGAACGCGCTAATTGTCG ATTGGACGGGTATTTACAAGGCTGATATTGGACTAAAAGATGGAATGATCTGCGGAATCGGCAAAGCTGG AAACCCAGACGTGATGGATGGTGTCACCCCCAATATGATAGTTGGCTCTTCGACAGATGTTATCGCATGT GAAGGAAAAATTGTCACTGCAGGAGGAATTGACACACACGTCCATTTTATATGCCCACAGCAGGTCGAGG AAGCCCTCGCCTCCGGAGTCACGACTCTTCTCGGTGGCGGCACCGGTCCAACTGAGGGAACAAATGCGAC TACATGCACACCGGCTCCAAATCAATTCAAGACGATGATGCAGGCTTGTGATCATCTTCCAATAAACGTT GGCCTTACAGGCAAAGGTAATGACAGCGGTCTTCCATCTCTGAGGGATCAATGCCGTGCAGGAGCCGCCG GCTTGAAGGTGCATGAAGATTGGGGTGCAACGCCGGCTGTCATTGATACATGCCTCCAGGTCTGCGACGA GTTCGATATTCAATGTCTCATCCATACCGACACCCTGAACGAATCTGGCTTCGTTGAACAGACCGTCAAT GCCTTTAAAAATCGAGTGATTCATACGTACCACACTGAGGGTGCTGGAGGAGGCCACGCTCCAGATATCA TATCCGTCGTCGAGAAGCCAAACGTCCTGCCCAGCAGTACGAATCCCACTCGTCCGTATACGGTAAATAC TTTAGATGAACATCTGGACATGGTAATGGTCTGCCATCATTTGTCCAAAGATATTCCTGAAGACGTGGCT TTTGCGGAAAGCCGGATCCGATCCGAGACAATTGCTGCAGAAGACGTTCTTCATGACACGGGAGCCATCA GCATGCTATCCTCGGACTCTCAAGCTATGGGACGCTGTGGAGAAGTTGTTGTCCGGACATGGAACACTGC ACATAAGAATAAAATGGAACGAGGGCGACTCAAGGAGGATGAAGGGACGGATTCTGATAATTTTAGGGTT AAACGGTATATCAGCAAGTACACCATCAACCCTGCCATTGCACAGGGGATGGCCTACACTATTGGGAGCG TGGAAGTTGGCAAGACCGCTGATTTGGTTCTGTGGAAATTCGCCAACTTTGGGACTAAACCGAGTATGGT CTTGAAGTCTGGAATGGCTGTCTCAGCGCAGATGGGTGATCCCAATGGCTCTATCCCCACAATCGAGCCT ATTATTATGAGGCCTATGTACGCTAGTCTTAACCCTAAAGCCTCAATCATGTTCGTATCCCAAGCATCCA TCAAGCTTGGTATCATCGACAGTTACCACCTGAAGAAGCGGATCGAGCCAGTGAAGAATTGTCGGAATAT AAGCAAGAGAGATATGAAATTTAATGATATTATGCCCAAAATGAGAGTCGATCCGGAGAGCTATGTTGTC GAGGCTGACGGGGAAGAGTGTACCGCTGAGCCAGTGTCAGAGTTGCCTTTAACACAAGACTATTTCGTTT ACTGAAAATTGGTGGAGACCATAGAACGTCTCCACAGATTAGTCGTGGAAAAGTAATGCTCATGGCGATA GTATCCTTCTGTACCTCTTTTGATGAATATTAGTACATTTTATTGCATATCTATTCCTTTGGTCCTGTGC GTCTCCACGTGAGCATCCCTTTTTGCTAATCCCCAACGCCCTACAGAGATGGACCATTGACTTATCTGAA ATTCTAAATTCGCAATAAGCTCTCCCAGAAAAACAGTAAGATCACGCGCCCGGAACTCCTTGCTCCCAAA AAAAAAAAGGAATACAACTATTTAAAGCTCTTCATCCATCACAGTATGGTTATTGCCTGCCGAAATGAGC GAGTAGAGAGTCGACCACGTCTCGTGCTTGGCCGCACGATACGCAGAGATCCTTGAATGCATACGTCTTA GCATGGACGCCTTGCGGTCCTGACAACTAGGTGGGAGGGTTGTGGCTTGGGCCGGAT

Paste this sequence into blastx. What is the top result and how does it affect the host (brief)?
This tool automatically translates a sequence and checks for the protein in the database. Describe how that would be done biologically inside the infectious agent in detail

Solutions

Expert Solution

Question

a. Figure : result of blastx

a. The result of blastx show that top result is "unease". This is the enzyme used by bacteria to convert urea into carbamic acid and ammonia. This process is required by bacteria to colonize in the host.

b. The infectious agent convert first DNA into mRNA (messenger RNA) and finally convert mRNA into protein. Therefore infectious agent follow the central dogma of biology to convert it's DNA into protein via mRNA to translate the protein in the host body.

gladiator answered 1 year ago

Next > < Previous

Related Solutions

Microbes have several mechanisms of pathogenicity. Contrast pathogenicity and virulence. Describe five virulence factors found in...

Microbes have several mechanisms of pathogenicity. Contrast pathogenicity and virulence. Describe five virulence factors found in microbes and explain how each affects the establishment and success of disease.

In a certain risk group, individuals are tested for a certain disease S. A person who...

In a certain risk group, individuals are tested for a certain disease S. A person who has the disease gets the correct diagnosis with probability 0.99, whereas a person who does not suffer from S gets the correct diagnosis with probability 0.95. Furthermore, it is known that 6% of the individuals in the group get the diagnosis “suffer from S”. Determine a) the proportion of individuals in the group who suffer from S, and b) the probability that a person...

Create columns as shown below: Name of Disease, Causative Agent(s), Virulence factors , Pathogenesis for the...

Create columns as shown below: Name of Disease, Causative Agent(s), Virulence factors , Pathogenesis for the following skin diseases Erysipelas, and Cutaneous candidiasis.

A lab technician is tested for her consistency by taking multiple measurements of cholesterol levels from...

A lab technician is tested for her consistency by taking multiple measurements of cholesterol levels from the same blood sample. The target accuracy in the past has been 2.5 or less with a standard deviation of 1.15. If the lab technician takes 16 measurements and the variance of the measurements in the sample is 2.2, does this provide enough evidence to reject the claim that the lab technician’s accuracy is within the target accuracy? At the a = .05 level...

A supreme court from a certain region recently ruled that employees can be tested for drugs...

A supreme court from a certain region recently ruled that employees can be tested for drugs only if management has reasonable cause to administer the test. An article in a certain magazine focused on the misclassification rates of such drug tests. A false positive occurs when a drug test administered to a non-drug user yields a positive result. A false negative occurs when a drug test administered to a drug user yields a negative result. Complete parts a and b....

From information found in the 2N3904’s datasheet (found with Google or on Blackboard), estimate the collector-emitter...

From information found in the 2N3904’s datasheet (found with Google or on Blackboard), estimate the collector-emitter saturation voltage of the 2N3904 transistor at a collector current of 15 mA. You may perform a linear interpolation between the values found in the datasheet (ie: use the point-gradient formula learned in high school).

Fill amounts of jars of peanuts from a certain factors are known to follow a Normal...

Fill amounts of jars of peanuts from a certain factors are known to follow a Normal distribution with mean 454g and standard deviation 15g. Suppose that a random sample of 8 jars is taken. What is the probability that the average weight of this sample is between 451g and 458g?

A survey of 822 randomly selected registered voters from a certain district found that 70.1% claimed...

A survey of 822 randomly selected registered voters from a certain district found that 70.1% claimed to have voted in the last presidential election. Determine how many registered voters in this survey claimed to have voted in the last presidential election. Find a 95% confidence interval estimate for the proportion of registered voters who say they voted in the last presidential election in this district. Are the survey results consistent with the actual voter turnout for this district (which was...

An organization surveyed 613 high school seniors from a certain country and found that 325 believed...

An organization surveyed 613 high school seniors from a certain country and found that 325 believed they would not have enough money to live comfortably in college. The folks at the organization want to know if this represents sufficient evidence to conclude a majority (more than 50%) of high school seniors in the country believe they will not have enough money in college. (a) What does it mean to make a Type II error for this test? (b) If the...

An organization surveyed 617 high school seniors from a certain country and found that 327 believed...

An organization surveyed 617 high school seniors from a certain country and found that 327 believed they would not have enough money to live comfortably in college. The folks at the organization want to know if this represents sufficient evidence to conclude a majority (more than 50%) of high school seniors in the country believe they will not have enough money in college. (a) If the researcher decides to test this hypothesis at the alpha (α) equals=0.05 level of significance,...

Subjects