Question

In: Anatomy and Physiology

Please compare why angioplasty goes through the femoral artery instead of the femoral vein like the...

Please compare why angioplasty goes through the femoral artery instead of the femoral vein like the ablation procedure. If you are struggling trace the path from the femoral vein to the descending branch of the left coronary artery.

THANK YOU IN ADVANCE!! :) also please write the answer fully and neatly so i can rate you a thumbs up! ^___^

Solutions

Expert Solution

An angioplasty is done in an individual to relive atherosclerotic plaque or occlusion that has taken place in a blood vessel of our heart . The major angioplasty procedures are conducted in the coronary arteries like the left and the right coronary artery. In this procedures the catheter is to reach the site of plaque that is the coronary artey . So to reach the coronary artey the way is to insert the catheter into the arteries of our arm that is the radial artery and also through the artery of our limb that is the femoral artery . So by moving up through the femoral artery is the best way to reach the coronary artey. From the femoral artery the catheters will move up to the common iliac artery and then move to the abdominal aorta and then the catheters will move up to the thoracic aorta which then further move up to the aortic arch and through one of the aortic sinus it will move into the coronary artey and help to relive the block in the individual. So the best route is through the arteries and not vein as if inserted through vein then longer distance is to be travelled when compared .

While in case of ablation therapy the situation is diffrent as this procedure is mainly indicated to relieve atrial fibrillation in the individual . So in this procedure the best way to heart of the individual is through the femoral vein which helps the catheter to move to the right atrium and then to the site to be repaired .

In case of angioplasty the need is to reach the left side of the heart so the femoral artery is used while in case of ablation therapy the right side is more preferred . So the vein is used


Related Solutions

What vein is used most commonly as the approach during pacemaker insertion? Why would the femoral...
What vein is used most commonly as the approach during pacemaker insertion? Why would the femoral vein ever be chosen as an approach? List 2 arrhythmias that may require defibrillation. List a few arrhythmias that might require synchronized cardioversion.
​Why is it important for marketers to recognize the stages that a consumer goes through in...
​Why is it important for marketers to recognize the stages that a consumer goes through in making a purchase decision?
Describe the general process one goes through to obtain their broker real estate license. please no...
Describe the general process one goes through to obtain their broker real estate license. please no hand written, mucho respect
I am sure you have heard the saying that goes something like why fix what isn't...
I am sure you have heard the saying that goes something like why fix what isn't broken, but how will you know if it is broken. Policies and procedures are usually seldom reviewed once implemented which can prove to be disastrous. Explain why and how often a facility should review and update the security policy.
Please explain why B is the correct answer, I know on the 5'---->3' it goes reverse...
Please explain why B is the correct answer, I know on the 5'---->3' it goes reverse and 3'-->5' it goes forward.......I got lost after this. Please explain. Will give a thumbs up. ----- Which of the following sets of primers could you use to amplify the target DNA sequence below, which is part of the last protein-coding exon of the gene involved in cystic fibrosis? 5’- ggctaagatctgaattttccgag … ttgggcaataatgtagcgcctt - 3’ 3’- ccgattctagacttaaaaggctc … aacccgttattacatcgcggaa – 5’ a) 5’ GGAAAATTCAGATCTTAG...
Please explain why the Health Care Provider would prescribe Warfarin instead of Dabigatran or Rivaroxaban to...
Please explain why the Health Care Provider would prescribe Warfarin instead of Dabigatran or Rivaroxaban to a patient who was recently diagnosed with Paroxsymal Atrial Fibrillation. The patient states " I don't want to take rat poison".How should the Provider respond ? For complete credit please list the risks and benefits to each drug.
Please explain why the Health Care Provider would prescribe Warfarin instead of Dabigatran or Rivaroxaban to...
Please explain why the Health Care Provider would prescribe Warfarin instead of Dabigatran or Rivaroxaban to a patient who was recently diagnosed with Paroxsymal Atrial Fibrillation. The patient states " I don't want to take rat poison ". How should the nurse practitioner respond ? For complete credit please list the risks and benefits to each drug.
Please explain in brief. 1. Why is the market for healthcare not like the market for...
Please explain in brief. 1. Why is the market for healthcare not like the market for Starbucks coffee? 2. Provide three characteristics that prevent health care markets from allocating resources efficiently? 3. What is Market failure?
What types of fraud are least likely to be detected through a hotline AND WHY? *Please...
What types of fraud are least likely to be detected through a hotline AND WHY? *Please make sure to answer the second part of the question as I have found several answers that are simply statements without explanations.
Compare the trade-off theory with the Modigliani-Miller theory. Which theory do you like better? Why
Compare the trade-off theory with the Modigliani-Miller theory. Which theory do you like better? Why
ADVERTISEMENT
ADVERTISEMENT
ADVERTISEMENT