Which of the following is a palindromic sequence? GAATTC GATTAG CATTAG ATCCTA GATATG please explain why....

Which of the following is a palindromic sequence?

GAATTC

GATTAG

CATTAG

ATCCTA

GATATG

please explain why. I really do not understand .

Expert Solution

queen_honey_blossom answered 2 years ago

Find sequences that satisfy the following or explain why no such sequence exists: a) A sequence...

Find sequences that satisfy the following or explain why no such sequence exists: a) A sequence with subsequences converging to 1, 2, and 3. b) A sequence that is bounded above, but has no convergent subsequence. c) A sequence that has a convergent subsequence but is unbounded (note: unbounded means not bounded below or not bounded above. d) A sequence that is monotonic and bounded, but does not converge.

Describe what a palindromic sequence is in DNA. How do restriction enzymes work? What would the...

Describe what a palindromic sequence is in DNA. How do restriction enzymes work? What would the sticky ends be for EcoR1 (which cuts GAATTC between the G and A)?

40. Which of the following is not necessarily conserved? AND PLEASE EXPLAIN WHY. :) A. lepton...

40. Which of the following is not necessarily conserved? AND PLEASE EXPLAIN WHY. :) A. lepton number B. baryon number C. meson number D. energy hint, the answer-key says C.

Which of the following would be most likely to reduce frictional unemployment? EXPLAIN WHY PLEASE a...

Which of the following would be most likely to reduce frictional unemployment? EXPLAIN WHY PLEASE a The government increases unemployment insurance benefits. b A new law bans labor unions c the government eliminates the minimum wage. d More workers post their resumes at LinkedIn.com, and more employers use LinkedIn.com to find suitable workers to hire. E. Sectoral shifts become more frequent.

Please explain why Which of the following people have an insurable interest in Mike’s life? A....

*Please explain why* Which of the following people have an insurable interest in Mike’s life? A. Angel, Mike’s 25-year old daughter B. James, Mike’s 30-year old son C. Cassie, Mike’s ex-wife and angel’s mother D. John, Mike’s employer E. Donna, Mike’s daughter in law F. Scott, Mike’s business partner G. Rite, Mike’s fiancée

Which of the following statements is NOT correct? (Please explain why answer E is correct) a)corporate...

Which of the following statements is NOT correct? (Please explain why answer E is correct) a)corporate governance is the set of rules that control a company's behavior towards its directors, managers, employees, shareholders, creditors, customers, competitors, and community b) agency problem is that managers may act in their own interests and not on behalf of stockholders. c) Corporate governance is the set of rules that control a company's behavior towards its directors, managers, employees, shareholders, creditors, customers, competitors, and community....

1. Please briefly explain the following. a.) Discuss the sequence of events in the B-cell response...

1. Please briefly explain the following. a.) Discuss the sequence of events in the B-cell response to a thymus-dependent antigen. b.) Discuss the structure and function of class I and II MHC molecules. c.) Discuss the development of T cells in the thymus.

Which one of the following statements is true? Please explain each choice: why it is true/false....

Which one of the following statements is true? Please explain each choice: why it is true/false. (a) The Burgers vector of an edge dislocation is normal to the dislocation line and normal to the slip plane. (b) The Burgers vector of a screw dislocation is normal to the dislocation line and parallel to the slip plane. (c) When a screw dislocation enables slip in a single crystal, the dislocation line remains in the slip plane. (d) BCC crystals do not...

Design primers for the following target sequence which is to be amplified using PCR: CGGCTATCAGGATTGTTCTCTGGACCGTACATCGAACGGCTATCGAGGATTGTTCTCTGGACCGTACATTAAA Explain...

Design primers for the following target sequence which is to be amplified using PCR: CGGCTATCAGGATTGTTCTCTGGACCGTACATCGAACGGCTATCGAGGATTGTTCTCTGGACCGTACATTAAA Explain how you went about designing them.

Which of the following is NOT a sequence of DNA that could be cut by a...

Which of the following is NOT a sequence of DNA that could be cut by a restriction enzyme? a. GAATTC b. ATCGAT c. GTAC d. GTTCCA e. AGATCT Why?

Question