Question

In: Biology

Complete each sentence about the effects that mutations can have on DNA structure and expression. In...

Complete each sentence about the effects that mutations can have on DNA structure and expression.

In general, the more prevalent form of a gene and its associated phenotype is
called the  ____________ .

A mutation from wild type to a mutant form is a  ____________  mutation.

The effect of a forward mutation
can be reversed by a second mutation that restores the wild-type  ____________ .

When the second mutation is
at the same site as the original mutation (e.g., the same base pair in a codon), it is called a  ____________ mutation.

If the wild-type phenotype is restored by a
second mutation at a different site than the original mutation, it is called a  ____________  mutation.

Choices

Forward, Phenotype, Reversion, Wild Type, Suppressor

An effective selection technique uses incubation conditions under which the  ____________  grows because of properties conferred by the mutation, whereas the wild type does not.

In order to isolate revertants from a lysine  ____________ , a large population of lysine auxotrophs is plated on minimal medium lacking lysine, incubated, and examined for colony formation.

Only cells that have mutated to restore the ability to synthesize lysine will grow on  ____________ .

Several million cells can be plated on a single Petri dish, but only the rare  ____________  cells will grow.

Thus many cells can be tested for  ____________  by scanning a few Petri dishes for growth.

Choices

Minimal medium, revertant, auxotroph, mutant, mutations

Solutions

Expert Solution

Please rate high.


Related Solutions

Two mutations complement each other. What can be said about this? a) The mutations are not...
Two mutations complement each other. What can be said about this? a) The mutations are not in essential genes. b) The mutations are epigenetic. c) The mutations affect the same gene. d) The mutations affect different genes. e) None of the above.
DNA mutations can occur in a variety of ways. Choose one of the ways that DNA...
DNA mutations can occur in a variety of ways. Choose one of the ways that DNA mutations can occur that you are learning about this week, identify and briefly describe it. Then, choose a genetic mutation (it can be from your textbook, one you are aware of, or one you learn about through your research of this topic), and describe the type of mutation that it involves. Consider if it affects the ability of the organism to produce proteins correctly,...
Mutations in certain genes can interfere with DNA replication and DNA repair and lead to tumor...
Mutations in certain genes can interfere with DNA replication and DNA repair and lead to tumor formation (cancer). In 1-2 complete sentences, describe which cell cycle checkpoints are most likely disrupted by these genes and explain why this would lead to cancerous cells?
Complete each sentence, formula or phrase with the answer that best completes the sentence: 6 In...
Complete each sentence, formula or phrase with the answer that best completes the sentence: 6 In a __________________________ acquisition, both the acquirer and the acquired are in the same industry 7 A(n) _________________________is the same as a merger except that an entirely new firm is created. 8 Tax gains are sometimes sited as a reason for a merger. On such tax gain reason is to purchase a company with an NOL. NOL stands for __________________________ 9 _______________________ and ___________________ came...
Explain the different types of mutations that can occur in DNA and their potential severity in...
Explain the different types of mutations that can occur in DNA and their potential severity in a protein product.
Complete each sentence, formula or phrase with the answer that best completes the sentence: 1 APV...
Complete each sentence, formula or phrase with the answer that best completes the sentence: 1 APV is similar to that of the NPV except that for the levered firm the APV=NPV of the of an unlevered firm + ____________________________________________________ 2 The ______________________approach discounts the aftertax cash flows from a project going to the equity holders of a levered firm using the cost of capital of equity holders in a levered firm. 3 In analysis of our Fed X vs UPS...
Mutations can occur in mRNA as well as DNA. Explain why a mutation in mRNA is...
Mutations can occur in mRNA as well as DNA. Explain why a mutation in mRNA is not likely to have serious consequences.
2. (6 pts) Speculate on the effects of each of the following mutations on the translation...
2. (6 pts) Speculate on the effects of each of the following mutations on the translation of the following mRNA. Specifically indicate whether any product would be made, and if so, if it would be altered in any way.  (GpppG is the 5’ cap) 5’GpppGUAACAUGGUCGGACCAUGAC(A)2003’ Mutation that removes the editing pocket from isoleucine-tRNA synthetase. Mutation that prevents GTP hydrolysis of eEF1-a. Mutation that prevents binding of GTP by eEF2.
Complete the following sentence for each of these investors: a. A buyer of call options …...
Complete the following sentence for each of these investors: a. A buyer of call options … b. A buyer of put options … c. A seller (writer) of call options … d. A seller (writer) of put options …
Insert the correct word to complete each sentence. Not all terms will be used.
Insert the correct word to complete each sentence. Not all terms will be used. 
ADVERTISEMENT
ADVERTISEMENT
ADVERTISEMENT