Question

In: Statistics and Probability

The longest "run" of S's in the sequence SSFSSSSFFS has length 4, corresponding to the S's...

The longest "run" of S's in the sequence SSFSSSSFFS has length 4, corresponding to the S's on the fourth, fifth, sixth, and seventh positions. Consider a binomial experiment with n = 4, and let y be the length (number of trials) in the longest run of S's. (Round your answers to four decimal places.)

(a) When p = 0.5, the 16 possible outcomes are equally likely. Determine the probability distribution of y in this case (first list all outcomes and the y value for each one).

Calculate μy.

(b) Repeat Part (a) for the case p = 0.4.

Calculate μy.

Solutions

Expert Solution


Related Solutions

The longest "run" of S's in the sequence SSFSSSSFFS has length 4, corresponding to the S's...
The longest "run" of S's in the sequence SSFSSSSFFS has length 4, corresponding to the S's on the fourth, fifth, sixth, and seventh positions. Consider a binomial experiment with n = 4, and let ybe the length (number of trials) in the longest run of S's. (Round your answers to four decimal places.) (a) When p = 0.5, the 16 possible outcomes are equally likely. Determine the probability distribution of y in this case (first list all outcomes and the...
4. Define the width of a rectangle as the longest length of its sides. Given a...
4. Define the width of a rectangle as the longest length of its sides. Given a closed rectangle A in Rn and a partition P of A, define the mesh of P as the maximum width of its subrectangles. Prove that a bounded function f : A → R is integrable on A if and only if, for every > 0, there is a δ > 0 such that U(f, P) − L(f, P) < for every partition P of...
Draw the labelled tree corresponding to the Prufer sequence 【3,3,4,4,5,5】
Draw the labelled tree corresponding to the Prufer sequence 【3,3,4,4,5,5】
Give a recurrence relation to find the length of the longest monotonically increasing subsequent of a...
Give a recurrence relation to find the length of the longest monotonically increasing subsequent of a array. Give the recursive algorithm based on the recurrence relation and explain the time complexity of this algorithm.
6. Write a function to count a tree’s height, which is the length of the longest...
6. Write a function to count a tree’s height, which is the length of the longest path from the root to a leaf. Please finish this question in python programming
a) A cylindrical length of wire has a radius of 4 mm and a length of...
a) A cylindrical length of wire has a radius of 4 mm and a length of 10 cm. If the length is growing at a rate of 2 cm/sec and the radius is shrinking at a rate of 1 mm/sec, what is the rate of change of the volume in cm3/sec at that point in time. (Be careful of units) b) Consider the same length of wire as before (radius of 4 mm and length of 10 cm). This time...
Make a function in Python that can do the following: Longest Increasing Sub-sequence: The input is...
Make a function in Python that can do the following: Longest Increasing Sub-sequence: The input is a sequence of numbers and the goal is to find a subsequence of the given sequence in which the subsequence's elements are in increasing order. You are looking for the longest possible such subsequence.
Let X and Y be two arrays and you want to find their longest common sequence...
Let X and Y be two arrays and you want to find their longest common sequence (LCS). Describe how you can calculate it in a space complexity of O(min{|X|, |Y|}). NOT O(|X| * |Y|). Pseudocode is not necessary but a detailed explanation of the idea will be very helpful.
Write a python script to calculate the average length of the game shortest game , longest...
Write a python script to calculate the average length of the game shortest game , longest game and the overall average length of a snake and ladder game The game length is the number of throws of the die. We are asked to write a python script which calculate that together with the average
Using the following DNA sequence, come up with your own corresponding sequence after a 1) point...
Using the following DNA sequence, come up with your own corresponding sequence after a 1) point mutation and 2) frameshift mutation. Also write out the corresponding RNA sequence: AGTAAACGTACCTGAGACGGG Explain how gene regulation in eukaryotes differs from gene regulation in prokaryotes.
ADVERTISEMENT
ADVERTISEMENT
ADVERTISEMENT