Question

In: Biology

The diagram of a eukaryotic ribosome shown below contains several errors

Part A

Examine the diagram carefully, and identify each error. Select all that apply.

the number of ribosomal subunits is incorrect

the ribosome is moving in the wrong direction along the MRNA

the amino acid on the tRNA in the A site is incorrect

the terminal amino acid of the peptide is incorrect

the MRNA incorrectly contains Ts

the MRNA incorrectly contains adenines

small ribosomal subunit size is incorrect

the amino acids on the tRNA in the P site are incorrect

large ribosomal subunit size is incorrect

the anticodon sequence of the tRNA in the P site is incorrect

the tRNA incorrectly contains cytosines

Expert Solution

1. TRUE
The number of ribosome subunits = 2
Prokaryotes = 50S + 30S
Eukaryotes = 60S + 40S

2. TRUE
The ribosome translocates along the mRNA in 5'-3' direction

3. TRUE
Codon = 3'-ACC-3'
Anticodon should be 5'-UGG-3'

4. TRUE
The N-terminal amino acid should be Met

5. TRUE
The mRNA contains Uracil in the place of Thymine

6. FALSE
The mRNA contains AUGC bases.

7. TRUE
Prokaryotes = 50S + 30S
Eukaryotes = 60S + 40S

8. TRUE
GCA = Ala

9. TRUE
Prokaryotes = 50S + 30S
Eukaryotes = 60S + 40S

10. TRUE
The tRNA does not contain Thymine

11. FALSE
The base composition of tRNA = AUGC

gladiator answered 2 years ago

Describe how a ribosome builds proteins in a eukaryotic cell.

The energy level diagram of the hydrogen atom is shown the figure below

The energy level diagram of the hydrogen atom is shown the figure below. An atom generally has an electron in a given energy level, however, a transition may occur if the atom absorbs or emits a photon, or particle of light.Note: The energy of a photon can be written as \(E_{v}=h c / \lambda\) and the constants \(h c=1240 \mathrm{eV}-\mathrm{nm}\).1. In the Bohr model of the atom, energy is radiated whenA. an electron falls from an outer energy level to...

The structures of carbon dioxide and silicon dioxide are shown in the diagram below.

The structures of carbon dioxide and silicon dioxide are shown in the diagram below. Use your knowledge of structure and bonding to explain the following: a. Carbon dioxide is a gas at room temperature. b. Silicon(IV) oxide is a solid with a high melting point. c. Neither carbon dioxide nor silicon(IV) oxide conducts electricity.

The process flow diagram for an office chair is shown below. There are three steps on...

The process flow diagram for an office chair is shown below. There are three steps on a worker-paced line, and no inventory is stored between the steps. The processing times are: Base: 6 minutes/unit Upholstery: 10 minutes/unit Assembly: 8 minutes/unit Demand rate is 7 units/hour. What is the resource utilization at each unit? (Assume that there is sufficient input for the process). Resource Utilization = Flow Rate/ resource capacity Raw material - Base (6min/ unit)- upholstery (10 min/unit) - assembly...

The sketch below is a free-body diagram (with all the forces shown) of a bridge. The...

The sketch below is a free-body diagram (with all the forces shown) of a bridge. The distance are each 800 cm along the bottome of the bridge, "RL" to "A", "A" to "C", "C" to "B" and "B" to "R". The vertical height shown on the right side of the sketch is 1385 cm. The known forces are A= 5000 N, B= 3000 N and C= 10,000 N. You are to calculate the unknown reactions RLx, RLy and Rr.

Consider the molecular orbital diagram shown below, a diagram that is often applied to the first row diatomic molecules.

Consider the molecular orbital diagram shown below, a diagram that is often applied to the first row diatomic molecules. Note that this diagram comprises orbitals derived from the n = 2 valence shell of orbitals (2s and 2p). Use this diagram to determine (1) if the following diatomic molecules or ions will be diamagnetic (all electrons paired) or paramagnetic (one or more unpaired electrons), and (2) for paramagnetic species, the number of unpaired electrons.O2, N2, CO, NO, NO-, NO+, CN-,...

Ribosmal RNAs (rRNAs) are transcribed from rRNA genes, and eukaryotic ribosome subunits are assembled in the nucleolus.

1) Ribosmal RNAs (rRNAs) are transcribed from rRNA genes, and eukaryotic ribosome subunits are assembled in the nucleolus. How many times must a eukaryotic rRNA molecule cross the nuclear envelope before functioning in translation inside a functional ribosome in the cytosol of the cell?a) neverb) oncec) twiced) three times2) Polymerization of amino acids into a polypeptide requires energy. In terms of chemical thermodynamics, the chemical energy for peptide bond formation in translation technically comes from:a) hydrolysis of GTPb) hydrolysis of ATPc)...

About errors that can occur in the process of meiosis, and several types of errors are...

About errors that can occur in the process of meiosis, and several types of errors are mentioned. Select of these types of errors (e.g. chromosome number, non-disjunctions, etc.) and provide a brief description of the error. Then do a little bit of online research related to the type of error and identify and describe one disease or condition that can result from this type of error (example – Trisomy 21 is where there is an extra chromosome in the 21st...

A company is considering several alternatives that are shown below. If the firm uses a 10%...

A company is considering several alternatives that are shown below. If the firm uses a 10% interest rate and uses the rate of return approach to make the selection, which alternative should be chosen? P Q R S Initial Cost 19,000 16,000 11,000 8,500 Annual Ben. 3,500 3,100 2,200 1,350 Life 10 yrs 10 yrs 10 yrs 10 yrs

You are given a piece of eukaryotic DNA which is shown below /6 marks 5’- CACTCACCCGATTTTTGAATGGCCCTGATGAATCTCTGGTAA -3’...

You are given a piece of eukaryotic DNA which is shown below /6 marks 5’- CACTCACCCGATTTTTGAATGGCCCTGATGAATCTCTGGTAA -3’ a) If this is the coding strand, what is the mRNA produced (label both the 3’ and 5’ ends)? b) If this is the template strand, what is the mRNA produced (label both the 3’ and 5’ ends)? c) Assuming that the DNA sequence above is the coding strand, predict the amino-acid sequence of the protein produced from the piece of mRNA using single letter codes. In...