The following is a strand of eukaryotic cDNA DNA: 5'- catgtctdacagctggccgcca- 3' a) convert the dna...

The following is a strand of eukaryotic cDNA

DNA: 5'- catgtctdacagctggccgcca- 3'

a) convert the dna above to its complementary DNA strand (must labe the 5' or 3' ends)

b) dna is converted to mrna is process is called____?

c) convert this dna (5'- catgtctdacagctggccgcca- 3') to its mrna message

d) provide the protein sequence for this dna (5'- catgtctdacagctggccgcca- 3'_

remember this is done in a standard eukaryotic cell.

Solutions

Expert Solution

Answer-

a) Eukaryotic cDNA strand-

5'- CATGTCTDACAGCTGGCCGCCA - 3'

In this DNA strand one unusual base dihydrouridine (D) is present in DNA and this forms bond with adenine. So that in complementary DNA strand D forms bond with A.

Complementary DNA strand-

3'-GTACAGAATGTCGACCGGCGGT -5'

b) DNA is converted into mRNA by the RNA polymerase enzyme and process is called as transcription.

c) mRNA message- mRNA is synthesized in 5' to 3' direction using 3' to 5' DNA sequence as template. Instead thymine, uracil forms bond with adenine during transcription. So that mRNA message is-

5'- CAUGUCUUACAGCUGGCCGCCA -3'

d) Protein sequence- it starts from start codon 5'-AUG-3'. As cDNA is synthesized from mature mRNA in which introns are removed we can use this mRNA sequence directly for determination of protein sequence.

The mRNA codon is-

5'- C AUG UCU UAC AGC UGG CCG CCA -3'

Protein sequence is-

Met - Ser - Tyr - Ser - Trp - Pro - Pro

gladiator answered 1 year ago

Next > < Previous

Related Solutions

The following DNA sequence occurs at the start of a DNA strand: 3′—AATTGCAGATTCA—5′. Which of the...

The following DNA sequence occurs at the start of a DNA strand: 3′—AATTGCAGATTCA—5′. Which of the sequences below would most likely bind to this sequence to initiate DNA replication through the formation of RNA ? A. 5′—TTAACGTCTAAGT—3′ B. 3′—TTAACGTCTAAGT—5′ C. 3′—UUAACGUCUAAGU—5′ D. 5′—UUAACGUCUAAGU—3′

Transcription and Translation 1. Double strand of DNA: 5’-ATGTACCAGCATTCTCGATACCCT-3’ 3’-TACATGGTCGTAAGAGCTATGGGA-5’ mRNA strand made from the DNA:...

Transcription and Translation 1. Double strand of DNA: 5’-ATGTACCAGCATTCTCGATACCCT-3’ 3’-TACATGGTCGTAAGAGCTATGGGA-5’ mRNA strand made from the DNA: 5’-AUGUACCAGCAUUCUCGAUACCCU-3’ a) Which strand of the DNA is the template for mRNA synthesis? Select the correct answer: i. 5’ – 3’ ii. 3’ – 5’ (0.5 points) b) Draw an arrow on the DNA above, to show the direction of transcription i.e. in which order the nucleotides were added to create mRNA. (0.5 points) c) What is the peptide sequence of this piece of...

A sequence of a following DNA template strand 5' - GTAACGGGCACGTCC - 3' was transcribed to...

A sequence of a following DNA template strand 5' - GTAACGGGCACGTCC - 3' was transcribed to an mRNA that was then translated to a protein. What would be the first amino acid in the polypeptide? Assume that no start codon is needed

Describe the 5 events that convert an mRNA into a cDNA.

1. Given the non-template strand of DNA, draw the template strand with the 5' and 3'...

1. Given the non-template strand of DNA, draw the template strand with the 5' and 3' ends labeled. Draw the RNA molecule with the proper 5' and 3' ends labeled Non-Template Strand: 3'- AAT GCT CGT AGC TTC GAT CGG ATC GA-5' 2. How many amino acids would the RNA molecule code for?

Given the non-template strand of DNA, draw the template strand with the 5' and 3' ends...

Given the non-template strand of DNA, draw the template strand with the 5' and 3' ends labeled. Draw the RNA molecule with the proper 5' and 3' ends labeled Non-Template Strand: 3'- AAT GCT CGT AGC TTC GAT CGG ATC GA-5' My answers: Template= 5'- TAT CGA GCA TCG AAG CTA GCC TAG CT-3' RNA Molecule= 3'- AUA GCU CGU UGC UUC GAU CGG AUC GA-5' Next it asks, how many amino acids would the RNA molecule code for? -...

A DNA strand reads 5'AATCGTAGTC3'. The adjacent strand should read: 3'AATCGTAGTC5' 3'TTAGCATCAG5' 5'TTAGCATCAG3' None of the...

A DNA strand reads 5'AATCGTAGTC3'. The adjacent strand should read: 3'AATCGTAGTC5' 3'TTAGCATCAG5' 5'TTAGCATCAG3' None of the above All of the above

The codon in the DNA coding strand has the following sequence: 5' - TAC -3' Which...

The codon in the DNA coding strand has the following sequence: 5' - TAC -3' Which of the following codons (result of a mutation) represents a non-sense mutation? Select one: a. TAA b. TAT c. TTC d. TCC

Given the half of the DNA strand: 5'-GTTAGCCGTCTAATATGGTGAGATGTTATAACCCGCAGTTTACAACTTCAA-3' 1.At what part is of the peptide is...

Given the half of the DNA strand: 5'-GTTAGCCGTCTAATATGGTGAGATGTTATAACCCGCAGTTTACAACTTCAA-3' 1.At what part is of the peptide is where Arg located? At what part of the peptide is where the stop codon located? Where is the 5th cytosine located at the RNA strand? Where is the 6th uracil located at the RNA strand? How many Leu amino acids are transcribed? How many Pro amino acids are translated? What is the 7th amino acid translated? What is the 7th amino acid translated?

A single strand of DNA, 24 nucleotides long, with the sequence 5'-TTTCCCgggAAAgggTTTAAAggg-3' is in a test...

A single strand of DNA, 24 nucleotides long, with the sequence 5'-TTTCCCgggAAAgggTTTAAAggg-3' is in a test tube. (Note that G's are shown in lowercase, so that your eye can better distinguish them from C's) Other than the appropriate buffer solution, what else needs to go in the test tube to so that we end up with a piece of double stranded DNA, 24 base pairs long, with the above sequence comprising one of the two strands? (SELECT ALL THAT APPLY)...

Subjects