Question

In: Biology

Answer the following questions: 1. Which bases are purines? Pyrimidines? 2. Why does DNA need to...

Answer the following questions:

1. Which bases are purines? Pyrimidines?

2. Why does DNA need to replicate?

3. When in the cell cycle does DNA replication occur?

4. Does DNA replication occur in mitosis and meiosis? How does it differ in each?

5. Meselson and Stahl discovered that DNA replication is semi-conservative. Explain what that means.

6. DNA strands run in the opposite directions. What is this called and why is this an issue in DNA replication?

7. Why are the two strands of DNA said to be complementary?

8. Explain the difference between leading and lagging strand replication.

9. What are Okazaki fragments and why are they needed?

10. Why does the lagging strand require a primer?

11. DNA synthesis always occurs in the __________ direction, so one new strand is synthesized continuously towards the replication fork, producing the __________ strand. The other strand, known as the __________ strand, forms away from the replication fork in small fragments.

12. Explain the process of DNA replication, include all parts of initiation, elongation, termination, and the enzymes involved in each.

Solutions

Expert Solution

1. Adenine (A) and Guanine (G) are purines.

Thymine (T), Cytosine (C) and Uracil (U) are pyrimidines.

2. DNA needs to replication because existing cells divide to produce new cells. So, DNA is copied during S-phase of interphase cell cycle so that all the instructions in the parent cell are passed on to the daughter cells.

3. DNA replication occurs in the S-phase of Interphase.

4. Cell cycle is the ordered sequence of events. Cell cycle has two main phases namely interphase and M-phase.

Interphase is further divided into G1, S and G2. DNA synthesis takes place in S-phase.

Hence, DNA replication occurs during cell cycle but not in M-phase. So, there is no difference in DNA replication of mitosis and meiosis.

5. Meselson and Stahl discovered that DNA replication is semi-conservative. This means that two DNA stand unwind from each other and each acts as a template for synthesis of a new complementary strand. This gives two DNA molecules having one original strand and one new strand.

6. DNA strands run in the opposite directions. This is called anti-parallel nature of DNA or anti-parallel polarity, that is, one chain has polarity 5'-3' and the other has 3'-5'.

The anti-parallel structure of DNA for DNA replication because it replicates the leading strand one way and the lagging strand the other way.

7. The two DNA chains are held together by complementary base pairing, where A pairs T and G pairs with C. A and T are bond to each other by two hydrogen bonds and C and G are bound to each other by three hydrogen bonds. This is referred to as complementary base pairing.

8. Leading strand is replicated continuously which requires primer for synthesis while lagging strand is replicated discontinuously which requires a new primer to start each okazaki fragement.

Lagging strand requires DNA ligase to join the short strands of DNA synthesized while leading strand does not require DNA ligase as there is a continuous synthesis of DNA.

9. Okazaki fragments are short newly synthesized DNA sequences. The Okazaki fragments are important for DNA synthesis because no DNA polymerase can use 3' to 5' strand of DNA to use as a continuous template. Hence, okazaki fragments allow discontinuous DNA synthesis allowing DNA polymerase to work in backward direction moving away from replication fork. It then jumps back to the fork for next RNA primer to begin a new okazaki fragment.

10. Lagging strand is a discontinuous strand. As the lagging strand is oriented the opposite direction, the polymerase enzyme cannot accommodate it in the space due to the shape and location of the active site. It needs a primer to start each fragment. These oakazaki fragments are joined by ligase enzyme.

11. DNA synthesis always occurs in the 5’ TO 3’ direction, so one new strand is synthesized continuously towards the replication fork, producing the LEADING strand. The other strand, known as the LAGGING strand, forms away from the replication fork in small fragments.

12. DNA replication is the basis of biological inheritance. DNA is a self-replicating material present in almost living organisms on the chromosomes. It is present in a highly coiled structure within the nucleus. It consists of four bases (A, T, C and G), long backbone of sugar and phosphate.

The three main steps of DNA replication are: Initiation, Elongation and Termination.

Initiation

DNaA protein binds to the OriC which begins at the site of origin of replication. Helicases unwind the double helix by breaking the hydrogen bonds between complementary base pairs. Topoisomerase proteins surround the unzipping strands and relax the twisting to prevent the DNA from damage. Cell creates a short sequence of RNA known as RNA primers that are needed for elongation of the DNA.

Elongation

DNA polymerase catalyse the step by step addition of deoxyrionucleotide units to a DNA chain. At each growing fork one strand is called leading strand which is synthesized continuously from a single primer on the leading strand template and grows in 5’to 3’ direction. The other strand is lagging strand. Existing strand is called as template strand. Here, A pairs with T, C pairs with G.

DNA polymerase can add nucleotides only to 3’end of the growing strand. After 1000-2000 nucleotides of the leadings strand have been replicated, the first round of discontinuous strand synthesis on the lagging strand begins. Short pieces of DNA are repeatedly synthesized on the lagging strand. These short pieces of DNA are called Okazaki fragments. These fragments are joined by DNA ligase.

Termination

After elongation is complete, two new double helices have replaced the original helix. Replication terminates at the terminus region containing mutilple copies of about 23 bp sequences called Ter sequences. The lagging strand has a telomere section which contains a repeating non-coding sequence of bases. Telomeres are the regions of repetitive nucleotide sequences at the end of a chromatid which protect the end of the chromosomes from fusion with neighbouring chromosomes. Enzyme removes telomere at the end of the replication. Finally, nucleases proofread the new double helix structures. DNA polymerase fills the gaps created by the excised bases.

Each of these two daughter helices is a nearly same as that of the parental helix.


Related Solutions

1. Why does E. coli need both DNA polymerase III and DNA polymerase I? a. The...
1. Why does E. coli need both DNA polymerase III and DNA polymerase I? a. The DNA replication is bidirectional; one polymerase is used for each direction. b. Each polymerase is specific for only one strand of DNA. DNA polymerase III acts only on the leading strand, and DNA polymerase I acts only on the lagging strand. c. Only DNA polymerase I has proofreading ability. d. DNA polymerase III lacks the 5' → 3' exonuclease activity needed to remove RNA...
1. The enzyme responsible for recognizing damaged bases in DNA is __________ . a. DNA glycosylase...
1. The enzyme responsible for recognizing damaged bases in DNA is __________ . a. DNA glycosylase b. DNA polymerase c.DNA ligase exonuclease 2. What term is used to describe a species which affects the functioning of an allosteric enzyme? a. controller b. inhibitor c. regulator d. alloster 3 Which of the following statements is correct? a. adenine and guanine are both pyrimidines b. adenine and guanine are both purines c. adenine is a purine and guanine is a pyrimidine d....
Answer the following questions based on this codingstrand of DNA:                               &nbs
Answer the following questions based on this codingstrand of DNA:                                                                         5’ GGCCATGACAGAGGAGCAAAAGTTATTGCT 3’ Drennan et al. (1996) identified several mutations in this enzyme that result in methylmalonic acidemia (MMA). One of those mutations is a C to A at base pair 1904 in the coding strand of DNA (bold and italicized in the template strand). Write the unique coding strand of DNA for this patient and highlight the change you made. Write it 5’ to 3’. Write the mRNA sequence...
I. Use the DNA sequence below, which encodes a prokaryotic gene to answer the following questions....
I. Use the DNA sequence below, which encodes a prokaryotic gene to answer the following questions. 1 ATGAGGAGTT 11 GACACACAAG 21 AGGAGGTAGC 31 AGTATGGGTA 41 TAATCTAATG 51 CGTAATTGAG 61 GAGGTAGTTG 71 ACGTATGAAT 81 AGTTAACGTA 91 CGGGGGGGAA 101 ACCCCCCCTT 111 TTTTTTTTTC 121 GAGCAATAAA 131 AGGGTTACAG 141 ATTGCATGCT b) What region of this prokaryotic DNA sequence will be transcribed into mRNA? Circle one. 1-131 71-119 74-149 54-119 c) What will the sequence be for the protein translated from this mRNA? d) Where...
I need an answer to all three questions, please. Q1: Which of the following was not...
I need an answer to all three questions, please. Q1: Which of the following was not a policy response to the Economic crisis associated with the COVID-19 Crisis? Select one: a. The Fed lowered the policy rate by roughly 1.5 percentage points to nearly zero. b. The U.S. Congress passed a roughly $3 Trillion economic stimulus package. c. The Commonwealth of Massachusetts relaxed the balanced budget rule in the State Constitution. d. The Fed introduced facilities to keep markets liquid...
- Find 2 major brand in need of a major revitalization. 1. Why does it need...
- Find 2 major brand in need of a major revitalization. 1. Why does it need revitalization? 2.. What would you do from both a product and brand aspect?
After reading the following case, please answer the following questions: 1. Why does agency problem arise?...
After reading the following case, please answer the following questions: 1. Why does agency problem arise? 2. What is the cost of agency problem? 3. How to minimize the agency problem? CASE STUDY ON AGENCY PROBLEM ABC Company started operations in early 1970. The company produces specialized items for manufacturing cars. Most of the raw materials used are imported from Brazil because the cost is low and the labor is very cheap. The CEO for ABC Company, Mr. Rodriguez, makes...
Please answer the following questions. 1. Please explain why we need image rejection filter or image...
Please answer the following questions. 1. Please explain why we need image rejection filter or image rejection mixer and when we need with detail explanation. 2. Please introduce a couple of methods to remove image signals.
Please answer the following questions: 1.What does it mean “Fiat Money” and why did the modern...
Please answer the following questions: 1.What does it mean “Fiat Money” and why did the modern economies move to this payments system? 2.Calculate the total increase in deposit of a bank in the following case: Initial deposit: $ 2,000 RRR: 20 percent 3. Which component of the Federal Reserve System decides on the reserve requirement and what will be the effect of its reduction? Please answer them properly and Write in PRINT!
Answer one of the following questions (minimum 200 words).   1. Why does Descates worry that everything...
Answer one of the following questions (minimum 200 words).   1. Why does Descates worry that everything everyone has ever believed anout anything important (in science, religion, politics, ethics) has turned out to be false? Should we worry about this? 2. Does Descartes prove that he exisits as a thinking being? Evaluate the cogito argument. 3. Is there any way to know (with certainty) that you are not dreaming or the victim of a matix like situation? If so say where...
ADVERTISEMENT
ADVERTISEMENT
ADVERTISEMENT