Question

In: Biology

Using the sequence below give an example of an insertion, deletion, SNP, inversion, and translocation. 3’-ATTCGGCCAGTTAGCCGATG-5’

  1. Using the sequence below give an example of an insertion, deletion, SNP, inversion, and translocation.

3’-ATTCGGCCAGTTAGCCGATG-5’

Solutions

Expert Solution

Insertion- It is the type of mutation where one or more bases are inserted or added. It causes frameshift mutation leading to change in the total amino acid sequences from the base where insertion has occured

Normal gene- 3’-ATTCGGCCAGTTAGCCGATG-5’

Insertion mutation- 3'-ATTCGGCCATAGTTAGCCGATG-5'

Deletion- It is the mutation where one or more basepair is deleted from the original sequence. It also causes frameshift mutation

Normal gene- 3’-ATTCGGCCAGTTAGCCGATG-5’

Deletion mutation- 3'-ATTCGGCAGTTAGCCGATG-5'

SNP-Single Nucleotide Polymorphism is the change in single base sequence in the genome between species which is passes through generations. they are genetic biomarkers

Normal gene- 3’-ATTCGGCCAGTTAGCCGATG-5’

SNP- 3'- ATTCGGCCAATTAGCCGATG-5'

Inversion mutation- It is the reversal of some part of the sequences of the gene

Normal gene- 3’-ATTCGGCCAGTTAGCCGATG-5’

Inversion mutation-3'-ATTCGCCCGATTAGCCCATG-5'

Translocation mutation- It is the transfer or movement of few bases from sequence of one gene to another gene sequence

Normal gene- 3’-ATTCGGCCAGT TAGCCGATG-5’

These mutations can cause genetic diseases.

Consider another gene- 3'- CAGGTTAGC TACTAATA-5'

Translocation mutation- 3'-ATTCGGCCAGTTACTAATA-5' AND 3'-CAGGTTAGCTAGCCGATG-5'


Related Solutions

Discuss the cause of down syndrome (ex: insertion, deletion, inversion, translocation or whole chromosome issue), signs,...
Discuss the cause of down syndrome (ex: insertion, deletion, inversion, translocation or whole chromosome issue), signs, symptoms and degrees of the disease
1.Deletion of the KKXX sequence in the translocation would lead to it trafficking to? 2.Addition of...
1.Deletion of the KKXX sequence in the translocation would lead to it trafficking to? 2.Addition of a KDEL to a protein X that is normally secreted would lead to it being trafficked to? 3.Blocking clathrin-coat assembly would inhibit trafficking between which compartments? 4.A protein that is normally sent to the lysosome has all asparagine (single letter abbreviation N) residues replaced with lysine. What would happen to trafficking of this protein?
Using a DNA sequence as an example, illustrate and describe the listed mutations - deletion -...
Using a DNA sequence as an example, illustrate and describe the listed mutations - deletion - insertion - nonsense mutation - substitution - back mutation
Find all of the inversions inversion taking (3, −5) to (3,5). Give all of the possible...
Find all of the inversions inversion taking (3, −5) to (3,5). Give all of the possible centers and their corresponding radii.
Below is a DNA sequence of Borrelia burgdorferi containing the sequence of one strand only. 5’-ACTTCAGGATCCACTGGGCCCGAATTCGTCCTGAGCTCTAGAGTCCTTCG-3’...
Below is a DNA sequence of Borrelia burgdorferi containing the sequence of one strand only. 5’-ACTTCAGGATCCACTGGGCCCGAATTCGTCCTGAGCTCTAGAGTCCTTCG-3’ A) Please make the DNA double stranded by writing the complementary strand of the DNA underneath the strand above. B) Find in internet restriction sites for BamHI, EcoRI and XbaI. Please place a box around each restriction site in the DNA. C) You choose to cut this DNA with all three restriction enzymes.  How many DNA fragments will you get? D) You choose to cut...
The insertion of an "A" immediately after (3' of) the "A" in the codon 5'-CAG-3' would...
The insertion of an "A" immediately after (3' of) the "A" in the codon 5'-CAG-3' would cause what type of mutation? Synonymous, or silent, mutation B. Anti-sense mutation C. Non-sense mutation D. noisy mutation E. Non-synonymous mutation
Give a worst-case input sequence of 6 numbers for Insertion Sort, containing the numbers 68, 12,...
Give a worst-case input sequence of 6 numbers for Insertion Sort, containing the numbers 68, 12, 43, 13, 58, and 21. No explanation/proof required.
An mRNA has the sequence 5’ GCCACCAUGGGGGGAAGGUGAAGACC 3’. (3 pts.) Write the sequence of template and...
An mRNA has the sequence 5’ GCCACCAUGGGGGGAAGGUGAAGACC 3’. (3 pts.) Write the sequence of template and nontemplate strands of the gene encoding this mRNA. Clearly indicate which is which and include 5’ and 3’ polarity. Change the font (where it says paragraph above) to "preformatted" to get a constant-width font the will make your sequence more readable. (3 pts) Use the genetic code to write the N to C sequence of the protein specified by this RNA. Remember that the...
Which is the mRNA complement of the DNA sequence 5’ ACGGTCGGAT 3’ 5’ ACGGTCGGAT 3’ 5’...
Which is the mRNA complement of the DNA sequence 5’ ACGGTCGGAT 3’ 5’ ACGGTCGGAT 3’ 5’ AUCCGACCGU 3’ 5’ TGCCAGCCTA 3’ 5’ UGCCAGCCUA 3’ Answer question a in the first row (with a number). For statements b-k, enter an X to indicate if it is associated with DNA replication, transcription or translation. A statement may apply to more than one. DNA Replication Transcription Translation Number of template DNA strands? ________ ________ N/A Uses DNA polymerase Uses RNA polymerase Requires ribosomes...
1. Give and explain 3 example of financial instrument 2. Give and explain 3 example of...
1. Give and explain 3 example of financial instrument 2. Give and explain 3 example of Generalized Audit Software 3. Why it called Generalized Audit Software? 4. Give 1 of the most famous GAS
ADVERTISEMENT
ADVERTISEMENT
ADVERTISEMENT