Question

In: Biology

DNA structure and replication (write down) Forensic DNA analysis what types if tools are used and...

DNA structure and replication (write down)
Forensic DNA analysis what types if tools are used and how do they confidently identify a criminal?

Solutions

Expert Solution

DNA structure and replication

  • Structure of DNA was given by Watson and Crick.They said that DNA is a right handed double helix.
  • DNA consists of 2 strands that are complementary to each other and run anti-parallelly.
  • Deoxyribonucleic acid (DNA) is composed of 4 deoxyribonucleotides-
  1. deoxyadenylate
  2. deoxyguanylate
  3. deoxycytidylate
  4. thymidylate
  • These units are linked by 3' to 5' phosphodiester bonds to form a long polypeptide chain.
  • The nucleotide chain is formed by a combination by base+sugar+phosphoric acid.
  • Base pairing rule: Chargaff's Rule
  1. Adenine always pairs with thymine with 2 hydrogen bonds between them.
  2. Cytosine always pairs with Guanine using 3 hydrogen bonds.

Forensic DNA Analysis:

Tools of DNA analysis include enzymes and fundamental procedures which allow amplification and detection of specific targets on the genome.

Types DNA Evidence Analysis

  • Polymerase Chain Reaction (PCR)
  • Short Tandem Repeats (STR)
  • Y-Chromosome
  • Mitochondrial DNA

1. PCR : It uses an enzyme (polymerase) to replicate DNA regions in a test tube. By repeating the copying process, a small number of DNA molecules can be reliably increased up to billions within several hours.

2. STR Analysis : It  is a forensic analysis that evaluates specific regions (loci) that are found on nuclear DNA.

3. Y-chromosome Analysis : Y-chromosome markers target only the male fraction of a biological sample. Y-chromosome is transmitted directly from a father to all of his sons, so ,it can also be used to trace family relationships among males.

4. Mitochondrial DNA Analysis: mtDNA technology analyzes DNA found in a different part of the cell, the mitochondrion. It allows forensic laboratories to develop DNA profiles from evidence that may not be suitable for RFLP or STR analysis.

Identification of criminal:

Sample to be collected: Blood, semen, urine, saliva, hair, and general debris present in the crime scene or on the clothing of the victim may help in the identification of the accused.

Forensic applications:

1)Murder: The blood or hair roots found on a weapon/clothing can be matched against that of the victim.

2)Sexual crimes: The seminal DNA obtained from the vaginal aspirates or swabs of the victim can be compared with the DNA in the blood sample of suspect. If they match, the suspect is the criminal.

3)Extortion cases: Saliva samples obtained from face masks,cigarettes butts,etc..are taken into consideration.

4)In hit and run traffic accidents,matching DNA from blood of victim from blood stains on the vehcle.


Related Solutions

what different purposes between the DNA replication and Transcription. what enzymes be used on DNA replication(at...
what different purposes between the DNA replication and Transcription. what enzymes be used on DNA replication(at least 3 types) and Transcription(at least 2 types).
What molecules are used as the building blocks of the new DNA strand in DNA replication...
What molecules are used as the building blocks of the new DNA strand in DNA replication (human body) versus PCR?
Use the six enzymes used during DNA replication to explain the process of DNA replication. Include...
Use the six enzymes used during DNA replication to explain the process of DNA replication. Include the function and purpose
Using your knowledge of DNA replication, copy the following. Write down all the important steps and...
Using your knowledge of DNA replication, copy the following. Write down all the important steps and players of the reaction. Show the primer location and derive the complimentary strand sequence. 5` - AGATTCTGAGTCGTGACTCGTACGTCATAACTT -3`
Using model materials to demonstrate DNA replication 1.    Present a detailed analysis of DNA replication at one...
Using model materials to demonstrate DNA replication 1.    Present a detailed analysis of DNA replication at one replication fork. Use drawing, descriptions, and/or captions detailing the process. 2.    In the analysis include the following: a.    Show how the leading and lagging strands are synthesized b.    Show the proteins (enzymes) involved in DNA replication and what their functions are
How are the DNA polymerases used in nature (DNA replication) and sequencing different? What other steps...
How are the DNA polymerases used in nature (DNA replication) and sequencing different? What other steps in DNA sequencing are different than prokaryotic DNA replication?
Describe in detail Watson - crick structure of Dna. How does this structure relate to replication...
Describe in detail Watson - crick structure of Dna. How does this structure relate to replication , transcription, and repair
describe the structure and replication of DNA and how it allows genetic information to be passed...
describe the structure and replication of DNA and how it allows genetic information to be passed on from generation to generation.
Describe the process of DNA replication; include the following terms: antiparallel structure, Topoisomerase, DNA polymerase I...
Describe the process of DNA replication; include the following terms: antiparallel structure, Topoisomerase, DNA polymerase I and III, leading strand, lagging strand, Okazaki fragments, DNA ligase, RNA primer, primase, helicase, single-strand binding proteins a. first on each strand - - - b. then on the lagging strand - - - c. then on the leading strand - - - and what are the differences between what happen between the leading and the lagging?
write a 2 - 3 sentence summarizing the process of DNA replication
write a 2 - 3 sentence summarizing the process of DNA replication
ADVERTISEMENT
ADVERTISEMENT
ADVERTISEMENT