although human DNA has a total length of 2 m, it is packaged into a nucleus...

although human DNA has a total length of 2 m, it is packaged into a nucleus that is 5 μm in diameter. Explain how this is possible.

Expert Solution

As DNA is elongated stucture larger in size than nucleus and cell it has to be packed tightly into a compact structure so as to fit into the cell. The DNA is wrapped around scaffold proteins to form chromatin which is 30 nm fibre. (Remember 1micrometer= 1000 nanometer) Chromatin again folded to form chromosome. Thus DNA can now fit in cell ( compare thread are wrapped to form a ball, thread is very long)

In detail, DNA are coiled around histone protein as beads on a string, ( 11 nm) this struxture is called nucleosome. Nucleosome contain 8 histone wrapled by DNA, called histone octamer, serves as the basic unit for organising higher level of chromatin structure. Nucleosomes are connected to each other by linker DNA. In the next level, nucleosome fold again into 30 nm fiber. They again fold into higher order structure. Condensed chromosome is about 700nm thick.

Thus the DNA are packed to fit in nucleus

gladiator answered 2 years ago

A rope of length L = 5.3 m with a total mass of m = 0.298...

A rope of length L = 5.3 m with a total mass of m = 0.298 kg is tied to a hook rigidly mounted into a wall. A pulse of height 1.4 cm is sent down the rope. The tension in the rope is F = 27 N. (A) Find the time between sending the pulse down the rope and detecting the pulse that returns. (B) What is the height of the pulse that returns?

A uniformly charged, straight filament 3.60 m in length has a total positive charge of 2.00...

A uniformly charged, straight filament 3.60 m in length has a total positive charge of 2.00 µC. An uncharged cardboard cylinder 4.30 cm in length and 10.0 cm in radius surrounds the filament at its center, with the filament as the axis of the cylinder. (a) Using reasonable approximations, find the electric field at the surface of the cylinder. magnitude Does the presence of the cardboard tube affect the electric field at its surface? kN/C direction ---Select--- radially outward radially...

organells that contain DNA include ____ 1) ribosomes 2) mitochondria 3) chloroplast 4) nucleus 5) a...

organells that contain DNA include ____ 1) ribosomes 2) mitochondria 3) chloroplast 4) nucleus 5) a , b

Slight wind of 2.2 m/s is moving over a human cheek of length .05m and is...

Slight wind of 2.2 m/s is moving over a human cheek of length .05m and is causing the skin to lose water. What is the thickness of the mass transfer boundary layer at half of the distance (0.025m) from the edge of the cheek surface over which this water loss is taking place? The viscosity of air can be assumed as 1.85*10-5 Pa.s, density of air is 1.2 kg/m3 and the diffusity of water vapor in air is 2.6*10-4 m2...

2. Although vitamins and minerals are vital for the proper functioning of human cells, excess intake...

2. Although vitamins and minerals are vital for the proper functioning of human cells, excess intake of certain vitamins and minerals can have deleterious consequences in the human body. Suppose you were to ingest all vitamins and minerals daily, but in slightly excessive amounts each day, over a long period of time. Which effects would you expect to observe first: those of an excessive intake of watersoluble vitamin, or those of an excessive intake of a fat-soluble vitamin, or those...

A crossing track was constructed over a water channel with a total length of 1700 m...

A crossing track was constructed over a water channel with a total length of 1700 m and width of 40 m. If you know that the maximum flow that can be carried by the water channel is 400 m3/s over a 25-year storm event. Calculate: a. The probability that the crossing track will flood next year. b. The probability that the crossing track will flood at least once in the next 12 years. c. The probability that the crossing track...

2.. The diagram below illustrates the human DNA nucleotide sequence containing the somatostatin gene. (2) •...

2.. The diagram below illustrates the human DNA nucleotide sequence containing the somatostatin gene. (2) • Highlight in red the bases between which EcoRI cuts on each strand of the DNA sequence. • Highlight in turquoise the bases between which BamHI cuts each strand of the DNA sequence. 5’ 3’ GAATTCATGGCTGGTTGTAAGAACTTCTTTTGGAAGACTTTCACTTCGTGTTAGTAGGATCC 3’ 5’ CTTAAGTACCGACCAACATTCTTGAAGAAAACCTTCTGAAAGTGAAGCACAATCATCCTAGG

A) A plastic block that has a length of 0.5 m, a width of 0.26 m,...

A) A plastic block that has a length of 0.5 m, a width of 0.26 m, and a height of 0.33 m, and has a density of 670 kg/m3 floats in both water and oil. If the plastic block is floating at the surface of a tank of water (which has a density of 1000 kg/m3), what is the distance from the top of the block to the surface of the water?If the plastic block is floating at the surface...

A flat surface of dimensions 2 m by 2 m that is given a total charge...

A flat surface of dimensions 2 m by 2 m that is given a total charge of 400 μC uniformly distributed over the surface, and where a point charge +4 μC is fixed a distance 2 cm above the centre of the charged surface. A second point charge +16 nC, with mass 10 g, is placed at rest directly above the first point charge, at a distance 2 cm from the first point charge. The second point charge is released...

Although human hearing has a theoretical range, this isn’t always the case in practice. Why is...

Although human hearing has a theoretical range, this isn’t always the case in practice. Why is that?

Question