If a piece of DNA has the sequence: ATGCCG, which of the following would indicate a...

If a piece of DNA has the sequence: ATGCCG, which of the following would indicate a frameshift insertion mutation?

ATGCCG

ATGGCG

TACGGC

ATGAACCG

Solutions

Expert Solution

Q) answer: 4th option (ATGAACCG)

frameshift mutation:

we know that frameshift mutation is one type of genetic mutation. it is caused by the insertion or deletion of one or more nucleotides in DNA or mRNA. this mutation alters the reading frame and effects on protein function.

A frameshift mutation shifts the grouping of bases after this mutation the codon codes to different aminoacids and also affects protein function. these mutations are associated with different diseases like Crohn's disease, stay Sachs disease, etc.

a frameshift mutation is divided into two types they are: 1) frameshift insertion mutation 2) frameshift deletion mutation.

1) frameshift insertion mutation: nothing but the addition of one or more bases in a DNA or mRNA.

example: in ATGCCG sequences after insertion" A" ( alanine) converts to form ATGAACCG.

2) frameshift deletion mutation: it is caused by the removal of one or more bases in DNA or mRNA.

example: in ATGCCG sequence after deletion of "C" converts to form ATGCG.

gladiator answered 1 year ago

Next > < Previous

Related Solutions

Which of the following is NOT a sequence of DNA that could be cut by a...

Which of the following is NOT a sequence of DNA that could be cut by a restriction enzyme? a. GAATTC b. ATCGAT c. GTAC d. GTTCCA e. AGATCT Why?

Write sequence of the DNA strand that would be complementary to the DNA sequence shown below....

Write sequence of the DNA strand that would be complementary to the DNA sequence shown below. Label the 3' and 5' ends ofthe new strand. 3' T A C C G A T G G 5'

the DNA template has the following sequence 5' TGATC 3'. When depurination occurs what sequence would...

the DNA template has the following sequence 5' TGATC 3'. When depurination occurs what sequence would occur in the daughter strand of the altered strand? a. 3' ACTA 5' b. 3' ACTAA 5' c. 3' ACTAG 5' d. 3' AAG 5'

10. The wildtype DNA has the following sequence:

10. The wildtype DNA has the following sequence: ACGATTACGAA It has undergone mutation and it now has the sequence (mutation is in BOLD): ACGACGCACGAA answer questions a-e below in the textbox under this question a. what is this type of mutation called? b. this type of mutation results in a protein that is shorter than usual. True or False c. what mutagen caused this mutation? d. what does this mutagen do to the DNA e. can this mutation be...

Given the sequence 5’-AGTTACCTGA-3’ what would be the sequence of the complementary DNA strand? Which of...

Given the sequence 5’-AGTTACCTGA-3’ what would be the sequence of the complementary DNA strand? Which of the following? 5’-TCAATGGACT-3’ 3’-AGTTACCTGA-5' ’5’-AGTTACCTGA-3’ 3’-TCAGGTAACT-5’ 5’-TCAGGTAACT-3’

The codon in the DNA coding strand has the following sequence: 5' - TAC -3' Which...

The codon in the DNA coding strand has the following sequence: 5' - TAC -3' Which of the following codons (result of a mutation) represents a non-sense mutation? Select one: a. TAA b. TAT c. TTC d. TCC

The following DNA sequence occurs at the start of a DNA strand: 3′—AATTGCAGATTCA—5′. Which of the...

The following DNA sequence occurs at the start of a DNA strand: 3′—AATTGCAGATTCA—5′. Which of the sequences below would most likely bind to this sequence to initiate DNA replication through the formation of RNA ? A. 5′—TTAACGTCTAAGT—3′ B. 3′—TTAACGTCTAAGT—5′ C. 3′—UUAACGUCUAAGU—5′ D. 5′—UUAACGUCUAAGU—3′

Indicate which of the amino acid residues in the following peptide sequence contains a group that...

Indicate which of the amino acid residues in the following peptide sequence contains a group that has a negative charge for its most likely charge state at pH 4. Met-Tyr-Ile-Trp-Gln-Val-Cys-Pro-Lys

On the sequence below: 1. Indicate the direction of transcription 2. Indicate which is the coding...

On the sequence below: 1. Indicate the direction of transcription 2. Indicate which is the coding strand and which one is the template for the transcription 3. Write down the mRNA 4. Write down the protein clearly indicating the first codon on the mRNA(hint: find the Kozak sequence RCCAUGG to identify the first codon) 5. Introduce a nonsense mutation 3' AGTCGACTGGCATCAGACTACGCTGTGACTGATACGCGTTTTATTGGATCGCACCGCATACAGGGCCCCGGTACCGTCCAAAACT CCCGAGTAGTCAGATGTCAGCAGCGAAATATACGG 5' 5'TCAGCTGACCGTAGTCTGATGCGACACTGACTATGCGCAAAATAACCTAGCGTGGCGTATGTCCCGGGGCCATGGCAGGTTTTGAGGGCTCATCAGTCTACAGT CGTCGCTTTATATGCC 3'

Which of the following are typically used to determine differences in DNA sequence between individuals? Select...

Which of the following are typically used to determine differences in DNA sequence between individuals? Select all that apply. a) cloning b) DNA fingerprinting of STRs c) DNA sequencing d) RFLP analysis e) gel-filtration chromatograpgy f) western blot

Subjects